Clec4d (NM_001163161) Mouse Untagged Clone
CAT#: MC206842
Clec4d (untagged) - Mouse C-type lectin domain family 4, member d (Clec4d), transcript variant 2, (10ug)
"NM_001163161" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Clec4d |
Synonyms | Clecsf8; mcl; Mpcl |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC206842 representing NM_001163161.
Blue=ORF Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGGCTGGAAGAATCCCAAATGAAATCAAAAGGTACCCGACATCCCCAACTGATCCCTTGCGTCTTC GCTGTTGTTTCCATCTCGTTCCTTAGTGCTTGCTTTATTTCAACTTGTTTGGTGACTCATCATTACTTT TTACGCTGGACGAGAGGAAGTGTGGTGAAACTGTCAGACTACCACACGAGAGTAACGTGCATCCGAGAG GAGCCACAGCCTGGAGCTACAGGTACTTGGACCTGCTGTCCTGTTAGCTGGAGAGCCTTCCAGTCTAAC TGTTACTTTCCTCTTAATGACAACCAGACCTGGCATGAGAGCGAGAGGAACTGCTCAGGGATGAGCAGT CATCTGGTGACCATCAACACCGAAGCAGAACAGAATTTTGTGACCCAGCTTTTGGATAAACGGTTTTCT TATTTCCTGGGACTTGCTGATGAGAATGTGGAAGGCCAATGGCAGTGGGTGGACAAGACGCCATTTAAC CCACACACGGTATTCTGGGAAAAGGGGGAATCCAATGACTTTATGGAAGAAGACTGTGTTGTCCTTGTT CATGTCCATGAAAAATGGGTCTGGAATGACTTTCCTTGTCACTTTGAGGTGAGAAGGATTTGTAAATTA CCTGGAATAACATTCAATTGGAAGCCCTCGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163161 |
Insert Size | 657 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001163161.1 |
RefSeq Size | 1333 bp |
RefSeq ORF | 657 bp |
Locus ID | 17474 |
UniProt ID | Q9Z2H6 |
Cytogenetics | 6 58.33 cM |
MW | 25.6 kDa |
Gene Summary | A calcium-dependent lectin involved in innate recognition of pathogen-associated molecular patterns (PAMPs). Interacts with signaling adapter Fc receptor gamma chain/FCER1G, likely via CLEC4E, to form a functional complex in antigen presenting cells. Binding of mycobacterial trehalose 6,6'-dimycolate (TDM) to this receptor complex leads to phosphorylation of the immunoreceptor tyrosine-based activation motif (ITAM) of FCER1G, triggering activation of SYK, CARD9 and NF-kappa-B, consequently driving maturation of antigen-presenting cells and shaping antigen-specific priming of T-cells toward effector T-helper 1 and T-helper 17 cell subtypes (PubMed:23602766). Functions as an endocytic receptor. May be involved in antigen uptake at the site of infection, either for clearance of the antigen, or for processing and further presentation to T-cells (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region compared to variant 1. This results in a shorter isoform (2) compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript from the same strain was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR202488 | Clec4d (Myc-DDK-tagged) - Mouse C-type lectin domain family 4, member d (Clec4d), transcript variant 2 |
USD 300.00 |
|
MR202488L3 | Lenti ORF clone of Clec4d (Myc-DDK-tagged) - Mouse C-type lectin domain family 4, member d (Clec4d), transcript variant 2 |
USD 600.00 |
|
MR202488L4 | Lenti ORF clone of Clec4d (mGFP-tagged) - Mouse C-type lectin domain family 4, member d (Clec4d), transcript variant 2 |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review