Tmem68 (NM_028097) Mouse Untagged Clone

CAT#: MC205341

Tmem68 (untagged) - Mouse transmembrane protein 68 (Tmem68), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tmem68 (NM_028097) Mouse Untagged Clone
Symbol Tmem68
Synonyms 2010300G19Rik; AA408325; AW123402
Vector pCMV6-Kan/Neo
Sequence Data
>BC016240
GGCACTACCCGCGTGTCTGCTTCTCCCGGCTCTGCCGCCGACCAGCTGCCGAGGTCGCCGATTTCCTGTG ACTTTCTTGTCAGAGTATATGCATTGAAGCTAAAGACAAGATATTTGTGTAATTTGTGTAATCTGGCATT GAAGTTGGAACATATGGCAATGAAGAAAGAGACAGGATTTGGGATTTTCATCTAAGAACATGATAGATAA CAACCAAACCTGTGCTGCAGGACAGGACTCTGTGCCCTATGTGACCTGTATGATTTATGTGCTTGAGGAG TGGTTGGGTGTGGAGCAATTGGAGGACTATCTGAATTTTGCAAACCATCTTTTGTGGGTTTTCACCCCAC TGATACTTTTAATACTTCCTTATTTTACCATCTTTCTTCTCTACCTTACTATTATTTTCCTCCATATCTA CAAGAGGAAGAATGTATTAAAAGAAGCCTACTCTCATAACTTGTGGGATGGTGCAAGGAAAACGGTGGCA ACTCTGTGGGATGGACATGCGGCTGTTTGGCATGGTTATGAAGTTCATGGGATGGAAAAGATACCAGAAG GAGCTGCACTTATAATTTTTTATCATGGAGCCATCCCCATAGACTTTTACTACTTCATGGCTAAAATTTT CATCCAGAAAGGCAGAACTTGCCGAGTAGTAGCTGACCACTTTGTCTTTAAAATTCCAGGGTTCAGTTTA TTACTTGATGTGTTTTGTGCTCTTCATGGACCAAGAGAAAAATGTGTTGAAATCTTGAGGAGTGGTCACT TGTTAGCTATCTCACCGGGCGGAGTTCGAGAAGCCTTACTTAGTGATGAAACCTACAACATCATATGGGG TAATCGTAAAGGCTTTGCTCAGGTTGCAATTGATGCAAAAGTGCCCATTATTCCTATGTTTACACAAAAT ATTCGAGAAGGATTTAGATCACTTGGAGGCACAAGATTATTTAAGTGGCTTTATGAAAAATTCCGCTATC CATTTGCTCCAATGTATGGAGGTTTTCCTGTAAAGTTGCGGACCTTCTTAGGTGATCCCATACCATATGA CCCAAAGGTAACAGCAGAAGAATTAGCCGAAAAGACCAAGAATGCTGTTCAAGCTTTGATTGACAAGCAC CAAAGGATACCGGGGAACATTAGGAGTGCTCTGCTGGACCGCTTTCATAAAGAGCAGAAGGCTCATTAGC AGATAGCTTAATGTGTCTGCAGTGACAAGTTTGCATCTGTGGTACTGTCTTGTAGGTTGTATATTGATTA GTGTTTTTAAAACGTTGTGCTAATGAACATCTTTCTTTAGAACTTAAACTTTATATGGTTAATCTTATCC TTTCAATCAGTTGTGTCAAATTTAATAAGTAGCTCATCATTTGCTTGACTCAGCAAATGATCATGTTGCA TTTGCAGTTTTTTTAGTAGTATATGATAAGCACAGAATCTTAGAGTTAAGTCTTCCTTGGTATCCGCAGA TTAGGTCAGGCAGACTTTACTAAATCATGTTTCTTATGTTTGTGTCTGTTGTGCCAATATGATAGTAGGG TGTAGCACTTGCTTAATTAAGATGAGTGATGCCTTTATGTATCTGTCCTTCATTCCATTCACAACTGCTG GCAAGTTGTGGAACTCTTTTGCACCTCAATGATTTATGTTAAGCATGCTAATACTGTGCTGATGAACATT ATTTTAAGTTGCTTATATCTACTGTGATATATCCATATATGATAGATATCTGTAGTGAGAATCTATAATT GAATTGATTCCTAAATCCTCTAGGAGTTATGTATATAATTTTGTCCATTGGATGTTGAAACTACTCCTTC AGGTATGATGTCCAGTTGCCAAGCACATTGAAAGAGATGTACTATTTTATAAATCAAATCATTGTTATTT GTAGTATTTATTAACCGAATTGTTTAGTATTTATTTTAAATAAGTATCTAAGGAAATGTATAGGATGAGT TGTCAGCACAGTGTTTTATGGTGTAAAGACAAAATCATGGGCATGCTCTGCAGTTCATGTTAGAAGTGGG TTCTAGGCTAAGGAATAACATGCTAAGACAGCTCTGGTCTCGCTCAGTATCCGGGCTCTCTTCCTGTGCT TTGCAGCCAGTAACGTGGTTATTATTTTAATAAAACGTACTTGAATGATAAACTTCTGTAAACATGGAGC TCTCTGAAAATGTAATTGCTTTTGATTTGTTGTCTTTTTGAAAACTTATTTTAAAAGTATTTAAACAACA AAGTATCATAAGCTCACTGCAGTATGTCTGTCTCCTACCACCTTTGTATACTTGGGTTTTATATGGACTT TTTAACTACAAGTGTTTATTTATGACATATATAATGTATATAGAAATGATGTGAAAATAAAGCTGAATTG CACCTCCTTCTCTAGTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_028097
ORF Size 990 bp
Insert Size 990
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC016240, NP_082373
RefSeq Size 2411
RefSeq ORF 990
Locus ID 72098
Cytogenetics 4|4 A1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.