Faim (NM_011810) Mouse Untagged Clone
CAT#: MC202435
Faim (untagged) - Mouse Fas apoptotic inhibitory molecule (Faim), transcript variant 2, (10ug)
"NM_011810" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Faim |
Synonyms | Faim-L, Faim-S |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC079662 sequence for NM_011810
GGAAAAAATGACGGATCTCGTAGCTGTTTGGGACGTAGCATTAAGTGACGGAGTCCACAAGATTGAATTT GAACATGGGACCACATCAGGCAAGCGGGTTGTGTACGTGGATGGGAAGGAAGAGATAAGAAGAGAGTGGA TGTTCAAGTTGGTGGGCAAAGAAACGTTCTTTGTCGGAGCTGCAAAAACCAAAGCCACCATCAATATAGA TGCCATAAGTGGCTTCGCATACGAGTACACGCTGGAAATTGATGGGAAGAGCCTCAAGAAGTACATGGAG AACAGGTCAAAGACCACCAGCACCTGGGTGCTGCGCCTGGATGGCGAGGACCTGAGAGTTGTTTTGGAAA AAGACACTATGGACGTATGGTGCAATGGTCAGAAAATGGAGACAGCGGGCGAGTTTGTAGATGATGGGAC TGAGACGCACTTCAGCGTTGGGAACCACGGCTGTTACATAAAAGCTGTGAGCAGCGGAAAGAGGAAAGAA GGGATTATCCATACCCTCATTGTGGATAACAGGGAAATCCCAGAGCTCACTCAGTGACACCTTCTTACTG AGTTCTGAGCCGAGGAGGTGACCTCGGGACTCGCCGATGGCTGTGGTAATTAAATGGGTTCAATATGTAC ATATTGTTAGATTTAGTCTGCAATGTTTTTATTTTTATCTTTTGTTACTTGAAACTGTAATATTCCAATG GTCAAGAAAAAACAAGGACTCATAAAAATGTATTTTTTAACTAATATAAAGTGTTTCTAATTCAAATGGA AAATAAAATGTGGACCAAACCACTAACATCCCACAACAGTAACCTTGACTGTAGTTAACACTGTAAAATA AAATGGTGCTGCTGGCCCTGCAAAAAAAAAAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | NM_011810 |
Insert Size | 540 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC079662, AAH79662 |
RefSeq Size | 877 bp |
RefSeq ORF | 540 bp |
Locus ID | 23873 |
UniProt ID | Q9WUD8 |
Cytogenetics | 9 E3.3 |
Gene Summary | Plays a role as an inducible effector molecule that mediates Fas resistance produced by surface Ig engagement in B cells.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks the exon containing the translation start codon compared to variant 1. The resulting isoform (Faim-S) has a shorter N-terminus compared to isoform Faim-L. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201595 | Faim (tGFP-tagged) - Mouse Fas apoptotic inhibitory molecule (Faim) |
USD 500.00 |
|
MR201595 | Faim (Myc-DDK-tagged) - Mouse Fas apoptotic inhibitory molecule (Faim), transcript variant 2 |
USD 300.00 |
|
MR201595L3 | Lenti ORF clone of Faim (Myc-DDK-tagged) - Mouse Fas apoptotic inhibitory molecule (Faim), transcript variant 2 |
USD 600.00 |
|
MR201595L4 | Lenti ORF clone of Faim (mGFP-tagged) - Mouse Fas apoptotic inhibitory molecule (Faim), transcript variant 2 |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review