Gpx3 (NM_008161) Mouse Untagged Clone

CAT#: MC202317

Gpx3 (untagged) - Mouse glutathione peroxidase 3 (Gpx3), transcript variant 2, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)


  "NM_008161" in other vectors (3)

Reconstitution Protocol

USD 242.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Goat Polyclonal Antibody against GPX3
    • 100 ug

USD 520.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Gpx3"

Specifications

Product Data
Type Mouse Untagged Clone
Symbol Gpx3
Synonyms AA960521; EGP; EGPx; GP; GPx; GSHPx-3; GSHPx-P
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC049235 sequence for NM_008161
GCCACCCCAAGACGCGCCCCAGCCCGCCATGGCCCGGATCCTCCGGGCATCCTGCCTTCTGTCCCTGCTC CTGGCCGGGTTTGTTCCGCCGGGCCGGGGACAAGAGAAGTCTAAGACAGACTGCCATGGCGGTATGAGTG GTACCATCTACGAGTATGGAGCCCTCACCATCGATGGGGAGGAATACATTCCTTTTAAGCAGTATGCAGG CAAATATATCCTCTTTGTCAACGTAGCCAGCTACTGAGGTCTGACAGACCAATACCTTGAACTGAATGCA CTACAAGAAGAACTTGGGCCATTTGGCTTGGTCATTCTGGGCTTCCCTTCCAACCAATTTGGCAAACAGG AGCCAGGCGAGAACTCGGAGATACTCCCCAGTCTCAAGTATGTTCGACCAGGTGGGGGCTTTGTGCCTAA TTTCCAGCTCTTTGAGAAAGGAGATGTGAACGGGGAGAAAGAGCAGAAATTCTACACTTTCCTGAAGAAC TCCTGCCCTCCCACTGCAGAACTCCTGGGCTCACCTGGCCGCCTCTTTTGGGAACCCATGAAGATCCATG ACATCCGCTGGAACTTTGAGAAGTTCCTGGTGGGGCCAGATGGCATACCGGTTATGCGCTGGTACCACCG GACCACAGTCAGCAACGTCAAGATGGACATCCTGTCTTACATGAGGCGGCAGGCAGCCCTGAGCGCCAGG GGGAAGTAACTGATGCCCCCACCCTACCCCTACCCCCTGCCCATCATGCAAGGGCCGAGGAGGGGCTCTT CAGGAAGGAAGCCACATTCCCAGTCATTCTACCCCCACCCCAGATTCTCTTTCTTATTACATAAAAGACA AGCCTGGCACAACTGTGTGTCTGAACCACTGTGGACACGTGACAATTGTCCCAGTGTGTGCATGGCTACA CAGCCACGTATCTGCCTGCTTGAAACCCAGGGATGGTCCATCTGTGTTTACGGCTTGGCACAACACCCTC ATATTTTTTTCAGCTTTCTGTTCCAAATGAGCCCAAAGGAAACACAAGTTCTAGGTCCAATGGTTCTGCT CAAACCTGAACATCATTCTTGGGGCCAGCATCTCCCACATGCCCACACTACACACCACCAGCCTCCTTCT TCCTTCCTGAAGGACCCTCCTGAGCCCCCAAGCCCATCCCACAGTGCTCCTGAGACCAGCCAAGACAACT GTGAGCGCGATGGCCGTGTACCCCAGGTCAGGGGTGGTGTTTCTATGAAGGAGGGGCCCGAAGCCCTTGT GGGCGGGCCTCCCCTGAGCCCGTCTGTGGTGCCAGCCCTTAGTGCATTCAGGCTTAGGCTCCCAGGCAGG GACACTACCCCCGCGCCTCTGGAGGACATGCTATCCTCTCACTCTGTCCACTGGTATCTCAACACCCCCA TCTGCCCAGTAAAGGTCTTTCTGCAGCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008161
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC049235, AAH49235
RefSeq Size 1442 bp
Locus ID 14778
UniProt ID P46412
Cytogenetics 11 B1.3
Gene Summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is secreted and is highly expressed in mouse kidney, which appears to be the major source of the enzyme in plasma. It has a role in mouse organogenesis, and dysregulation of this isozyme has been associated with obesity-related metabolic complications, platelet-dependent thrombosis, colitis-associated carcinoma, and thermosensitive phenotype. This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1) represents the predominant transcript and encodes isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.