Etfb (NM_026695) Mouse Untagged Clone

CAT#: MC202302

Etfb (untagged) - Mouse electron transferring flavoprotein, beta polypeptide (Etfb), (10ug)


  "NM_026695" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Etfb"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Etfb
Synonyms 0610009I16Rik; 2810441H06Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC049237 sequence for NM_026695
GGAAGATGGCGGAGCTGCGCGCGCTCGTGGCTGTCAAGAGGGTCATCGACTTCGCTGTGAAGATTCGGGT AAAGCCGGACAAGTCTGGAGTGGTCACTGATGGTGTGAAGCACTCCATGAACCCCTTCTGTGAGATTGCA GTGGAAGAGGCTGTGCGGCTAAAGGAGAAGAAACTGGTGAAGGAGATCATTGCCGTCAGCTGTGGCCCCT CACAGTGCCAGGAGACCATCCGAACTGCTCTGGCCATGGGTGCAGACAGAGGCATCCACGTGGAGATACC AGGGGCACAGGCAGAAAGCTTAGGCCCCCTGCAGGTGGCCCGGGTCCTGGCCAAGCTGGCTGAAAAGGAG AAAGTGGACCTTTTGTTCCTGGGCAAGCAGGCTATTGATGATGACTGTAACCAGACAGGTCAGATGACAG CTGGACTTCTGGACTGGCCGCAGGGTACATTCGCCTCTCAGGTGACACTGGAGGGGGACAAGGTAAAAGT GGAACGGGAAATTGACGGGGGTCTGGAGACCCTTCGCCTGAAGCTGCCCGCTGTGGTGACTGCTGACCTA AGGCTCAATGAGCCTCGCTATGCCACCCTGCCCAACATCATGAAAGCCAAGAAGAAGAAGATTGAAGTGG TCAAGGCTGGAGACCTGGGCGTGGACCTGACCTCCAAGGTCTCTGTGATCAGTGTGGAAGAGCCCCCTCA GCGCTCAGCAGGAGTCAAGGTGGAGACCACAGAAGACCTGGTGGCCAAGCTGAAGGAGGTGGGGCGGATC TGAGACCCTCCCTGATACTCTGCAATAAAACTGTGCCTTTCCAAGAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026695
Insert Size 768 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC049237, AAH49237
RefSeq Size 835 bp
RefSeq ORF 768 bp
Locus ID 110826
UniProt ID Q9DCW4
Cytogenetics 7 28.25 cM
Gene Summary Heterodimeric electron transfer flavoprotein that accepts electrons from several mitochondrial dehydrogenases, including acyl-CoA dehydrogenases, glutaryl-CoA and sarcosine dehydrogenase. It transfers the electrons to the main mitochondrial respiratory chain via ETF-ubiquinone oxidoreductase (By similarity). Required for normal mitochondrial fatty acid oxidation and normal amino acid metabolism (PubMed:25023281). ETFB binds an AMP molecule that probably has a purely structural role (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.