Pla2g2a (NM_001082531) Mouse Untagged Clone
CAT#: MC202297
Pla2g2a (untagged) - Mouse phospholipase A2, group IIA (platelets, synovial fluid) (Pla2g2a), (10ug)
"NM_001082531" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Pla2g2a |
Synonyms | EF; Mom1; Pla2; sPLA2; sPla2-IIA |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC045156 sequence for NM_001082531
CAAGAAACCATACCACCATCCAAGAGAGCTGACAGCATGAAGGTCCTCCTGCTGCTAGCAGCCTCGATCA TGGCCTTTGGCTCAATACAGGTCCAAGGGAACATTGCGCAGTTTGGGGAAATGATTCGGCTTAAGACAGG AAAGAGAGCTGAGCTTAGCTATGCCTTCTATGGATGCCACTGTGGCCTGGGTGGCAAAGGATCCCCCAAG GATGCCACAGACCGGTGCTGTGTTACTCATGACTGTTGCTACAAGAGCCTGGAGAAAAGTGGATGTGGTA CTAAGTTACTGAAATACAAGTACTCCCACCAAGGGGGCCAAATCACCTGTTCTGCAAACCAGAACTCCTG TCAGAAACGGCTGTGTCAGTGCGATAAAGCCGCCGCTGAATGTTTCGCCCGGAACAAGAAAACCTACAGT TTAAAGTACCAGTTCTACCCCAACATGTTTTGCAAAGGGAAGAAGCCCAAATGCTGAAAAGAGCCATCTC CTGAAACACCCGGACATGCGCGTCTCCCATCACACCTCTCCCAGCCCCACCAAGTTTCCCGGTGATAAAG GAAACACCCCTCTCCCACCCTAGAGGCAAGGTGGGGGCCCTTCTGTCTTCACCCAGAATGAGACACAGAA GTCTGCTGAGTCAGGCTGACCTTTCCCCACCACTCCACTGCCTTGAATCTGTCTACTTCCACCTTTCTCT TGGCATCCAACTTCCTGCTTCGTACCTAAGAGAGTCCTGGGAGGCCCTCACAAGTAAAGCAATTCATCAG ACAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_001082531 |
Insert Size | 441 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC045156, AAH45156 |
RefSeq Size | 793 bp |
RefSeq ORF | 441 bp |
Locus ID | 18780 |
UniProt ID | P31482 |
Cytogenetics | 4 70.57 cM |
Gene Summary | Proteins belonging to the phospholipase A2 (PLA2) family hydrolyze phospholipids into sn2 fatty acids and lysophospholipids. They function in a variety of cellular processes, including the digestion of phospholipids and the production of molecules that induce inflammatory responses. This gene encodes a member of the group II class of secretory PLA2s. The secreted enzyme binds to heparin on the cell surface. Mutations in this gene increase the occurrence of intestinal polyps caused by a dominant mutation in the adenomatosis polyposis coli gene. A frameshift inactivates this gene product in some mouse strains including the strain of the reference genome, C57BL/6J, whereas a functional protein is produced in other strains. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1, coding) contains a gap in the coding region to represent the functional allele that is not present in the the strain of the reference genome, C57BL/6J. Sequence Note: This RefSeq record was created to represent the transcript and the full-length, functional protein that is expressed in several strains. It does not contain a one nucleotide deletion that causes a frameshift in the CDS of several strains, including the strain of the reference genome, C57BL/6J. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200976 | Pla2g2a (Myc-DDK-tagged) - Mouse phospholipase A2, group IIA (platelets, synovial fluid) (Pla2g2a) |
USD 150.00 |
|
MR200976L3 | Lenti ORF clone of Pla2g2a (Myc-DDK-tagged) - Mouse phospholipase A2, group IIA (platelets, synovial fluid) (Pla2g2a) |
USD 450.00 |
|
MR200976L4 | Lenti ORF clone of Pla2g2a (mGFP-tagged) - Mouse phospholipase A2, group IIA (platelets, synovial fluid) (Pla2g2a) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review