Pla2g2a (NM_001082531) Mouse Untagged Clone

CAT#: MC202297

Pla2g2a (untagged) - Mouse phospholipase A2, group IIA (platelets, synovial fluid) (Pla2g2a), (10ug)


  "NM_001082531" in other vectors (3)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pla2g2a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pla2g2a
Synonyms EF; Mom1; Pla2; sPLA2; sPla2-IIA
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC045156 sequence for NM_001082531
CAAGAAACCATACCACCATCCAAGAGAGCTGACAGCATGAAGGTCCTCCTGCTGCTAGCAGCCTCGATCA TGGCCTTTGGCTCAATACAGGTCCAAGGGAACATTGCGCAGTTTGGGGAAATGATTCGGCTTAAGACAGG AAAGAGAGCTGAGCTTAGCTATGCCTTCTATGGATGCCACTGTGGCCTGGGTGGCAAAGGATCCCCCAAG GATGCCACAGACCGGTGCTGTGTTACTCATGACTGTTGCTACAAGAGCCTGGAGAAAAGTGGATGTGGTA CTAAGTTACTGAAATACAAGTACTCCCACCAAGGGGGCCAAATCACCTGTTCTGCAAACCAGAACTCCTG TCAGAAACGGCTGTGTCAGTGCGATAAAGCCGCCGCTGAATGTTTCGCCCGGAACAAGAAAACCTACAGT TTAAAGTACCAGTTCTACCCCAACATGTTTTGCAAAGGGAAGAAGCCCAAATGCTGAAAAGAGCCATCTC CTGAAACACCCGGACATGCGCGTCTCCCATCACACCTCTCCCAGCCCCACCAAGTTTCCCGGTGATAAAG GAAACACCCCTCTCCCACCCTAGAGGCAAGGTGGGGGCCCTTCTGTCTTCACCCAGAATGAGACACAGAA GTCTGCTGAGTCAGGCTGACCTTTCCCCACCACTCCACTGCCTTGAATCTGTCTACTTCCACCTTTCTCT TGGCATCCAACTTCCTGCTTCGTACCTAAGAGAGTCCTGGGAGGCCCTCACAAGTAAAGCAATTCATCAG ACAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_001082531
Insert Size 441 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC045156, AAH45156
RefSeq Size 793 bp
RefSeq ORF 441 bp
Locus ID 18780
UniProt ID P31482
Cytogenetics 4 70.57 cM
Gene Summary Proteins belonging to the phospholipase A2 (PLA2) family hydrolyze phospholipids into sn2 fatty acids and lysophospholipids. They function in a variety of cellular processes, including the digestion of phospholipids and the production of molecules that induce inflammatory responses. This gene encodes a member of the group II class of secretory PLA2s. The secreted enzyme binds to heparin on the cell surface. Mutations in this gene increase the occurrence of intestinal polyps caused by a dominant mutation in the adenomatosis polyposis coli gene. A frameshift inactivates this gene product in some mouse strains including the strain of the reference genome, C57BL/6J, whereas a functional protein is produced in other strains. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1, coding) contains a gap in the coding region to represent the functional allele that is not present in the the strain of the reference genome, C57BL/6J. Sequence Note: This RefSeq record was created to represent the transcript and the full-length, functional protein that is expressed in several strains. It does not contain a one nucleotide deletion that causes a frameshift in the CDS of several strains, including the strain of the reference genome, C57BL/6J.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.