Elof1 (NM_170777) Mouse Untagged Clone
CAT#: MC202133
Elof1 (untagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1), (10ug)
"NM_170777" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Elof1 |
Synonyms | 1110011K10Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024488 sequence for NM_170777
CCCACGCGTCCGAGCGGCCTTGGCTGAGAGGCAGGGCTGGTACAAGTTTTATTCCCTCTGCAGTTATGGG ACGAAGAAAGTCCAAACGGAAGCCGCCCCCAAAAAAGAAGATGACAGGCACCCTGGAGACCCAGTTCACC TGCCCTTTCTGCAACCACGAGAAGTCTTGTGATGTGAAAATGGACCGTGCTCGAAACACTGGAGTCATCT CCTGTACTGTGTGCCTAGAGGAATTCCAGACACCCATCACATACCTGTCAGAACCAGTGGATGTGTACAG CGACTGGATAGATGCCTGCGAGGCAGCCAATCAGTAGCAAAGTCAGGGACCTGCTCCTCCACAGCCCCCA TCTGGCTACCAATCCAGAGACATTCCAGGGCTAGGACAGCCCGCCCTCTGCAGATGGGATGGATGTGAGT GAGTAGATTTCGTGGCTGCAGATGTGACTGTAGGGATGGAGGCGAGCGACACTGGGTCTCACCAAGCAGC CCAGGGTGGCCTCATGGAACCCTGAGCCTCAGGTGACTCTACAAGCCTTTGAGTTGCTCCCATCTTCAGC CCCCACCCTGCCCCCACACTTCAGGCTCCTGTCTTCTCTGGTGACGGTTCCTGACATCCAGGCAAGGAAT AGCTGTGGGACCTCCTGTCTCCTCAGCCACCTCACCAGCACCTTGCCCTTGGGACCTAGACTTTCTGTCC TTCCCATTCTCCTAGTGCTGTGGTCGAGGCTACTGGCCACCCAGGTCCCCTGGCTGGGCTCGGCTGGGGA ACACCATTTTCTTGGTTTGCCTTTGTAGACAAGGTAGGGGCTAGTTGGGGTACAGCTGTCATTCATTCAT GAGCCCATCAATAAAACAGCCAGTGTGTAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_170777 |
Insert Size | 252 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024488, AAH24488 |
RefSeq Size | 884 bp |
RefSeq ORF | 252 bp |
Locus ID | 66126 |
UniProt ID | P60003 |
Cytogenetics | 9 A3 |
Gene Summary | Transcription elongation factor implicated in the maintenance of proper chromatin structure in actively transcribed regions.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. All seven variants encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200161 | Elof1 (tGFP-tagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1) |
USD 350.00 |
|
MR200161 | Elof1 (Myc-DDK-tagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1) |
USD 150.00 |
|
MR200161L3 | Lenti ORF clone of Elof1 (Myc-DDK-tagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1) |
USD 450.00 |
|
MR200161L4 | Lenti ORF clone of Elof1 (mGFP-tagged) - Mouse elongation factor 1 homolog (ELF1, S. cerevisiae) (Elof1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review