Psmb8 (NM_010724) Mouse Untagged Clone

CAT#: MC201912

Psmb8 (untagged) - Mouse proteasome (prosome, macropain) subunit, beta type 8 (large multifunctional peptidase 7) (Psmb8), (10ug)


  "NM_010724" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Psmb8"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Psmb8
Synonyms Lmp-7; Lmp7
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC051450 sequence for NM_010724
AAGAGGTAATCCCGGATCTTCGGGGCCAAGTGGCCATGGCGTTACTGGATCTGTGCGGTGCCGCTCGGGG GCAGCGGCCCGAGTGGGCTGCCCTGGATGCGGGAAGCGGGGGTCGCTCGGACCCGGGACACTACAGTTTC TCCGCGCAAGCTCCGGAGCTCGCACTTCCCCGGGGAATGCAGCCCACCGCATTCCTGAGGTCCTTTGGTG GTGACCAGGAAAGGAATGTTCAAATTGAGATGGCCCACGGCACAACCACACTCGCCTTCAAGTTCCAGCA TGGCGTCATCGTGGCTGTGGACTCCAGGGCCACTGCAGGGAGTTACATTAGCTCCTTAAGGATGAACAAA GTGATCGAGATTAACCCTTACCTGCTTGGCACCATGTCTGGTTGTGCAGCCGACTGCCAGTACTGGGAGA GGCTGTTGGCCAAGGAGTGCAGGTTGTGTTATCTTCGGAATGGGGAACGCATCTCCGTGTCTGCAGCATC CAAGCTGCTTTCCAACATGATGCTGCAGTACCGGGGGATGGGCCTCTCCATGGGCAGCATGATCTGTGGC TGGGACAAGAAGGGACCAGGACTTTACTACGTAGATGACAATGGGACTCGGCTCTCGGGACAGATGTTTC CCACTGGCAGCGGGAACACCTATGCCTATGGGGTGATGGACAGTGGTTACCGGCAGGACCTCAGTCCTGA AGAGGCCTACGACCTTGGCCGCAGAGCTATTGCTTATGCTACCCACAGAGACAACTATTCTGGAGGAGTC GTCAACATGTACCACATGAAGGAAGACGGTTGGGTGAAAGTGGAGAGTTCCGATGTCAGTGACCTGCTGT ACAAGTACGGAGAGGCCGCTCTGTGATGGCTGCTGGGCAGGCCTCCCCCAGCATTGGTGGCACTGGCTGG CAGACTCAGAGACCTGGGACTACTTCAGTCTTAGGAAAAAGAAGGGCTCAACCTGGGCTGGAGACAAAGC TCTGTTTACCCTCTCGGCCCCCGCACTCACAGATACCTTCTAAGTACAATAAAAGAAAAACGGTTATAAA AAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_010724
Insert Size 831 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC051450, AAH51450
RefSeq Size 1062 bp
RefSeq ORF 831 bp
Locus ID 16913
UniProt ID P28063
Cytogenetics 17 17.98 cM
Gene Summary The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity. This subunit is involved in antigen processing to generate class I binding peptides. May participate in the inflammatory response pathway. Required for adipocyte differentiation (PubMed:21881205, PubMed:22341445, PubMed:8066463). May be involved in the generation of spliced peptides resulting from the ligation of two separate proteasomal cleavage products that are not contiguous in the parental protein (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.