Lcat (NM_008490) Mouse Untagged Clone

CAT#: MC201471

Lcat (untagged) - Mouse lecithin cholesterol acyltransferase (Lcat), (10ug)


  "NM_008490" in other vectors (4)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Lcat"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lcat
Synonyms AI046659; D8Wsu61e
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC028861 sequence for NM_008490
GGCTGTGATGGGGCTGCCTGGCTCCCCATGGCAGCGGGTGCTGTTGCTGTTGGGGCTACTGCTCCCTCCT GCCACCCCCTTCTGGCTCCTCAATGTGCTCTTCCCCCCGCACACCACGCCCAAGGCTGAACTCAGTAACC ACACACGGCCTGTCATCCTCGTGCCTGGCTGCTTGGGGAATCGGCTAGAAGCCAAGCTGGATAAACCAGA TGTGGTGAACTGGATGTGCTACCGTAAGACAGAGGACTTCTTCACCATCTGGCTGGATTTCAACTTGTTT CTCCCCCTCGGGGTGGACTGCTGGATTGATAATACCAGGATTGTCTACAACCACAGCTCTGGGCGCGTGT CCAATGCCCCTGGTGTCCAGATCCGTGTCCCTGGCTTTGGCAAGACCGAATCTGTTGAGTACGTGGATGA CAACAAGCTAGCAGGCTACCTGCACACACTGGTGCAGAATCTGGTTAACAACGGATATGTGCGGGATGAG ACAGTGCGGGCCGCACCCTATGACTGGCGTCTGGCACCCCACCAGCAGGATGAATACTACAAGAAGCTGG CTGGCCTGGTAGAGGAGATGTATGCCGCTTATGGGAAGCCTGTCTTCCTCATTGGGCATAGCCTTGGCTG TCTGCATGTGCTCCACTTCTTACTGCGGCAGCCTCAGTCCTGGAAGGACCACTTCATTGATGGTTTTATC TCTCTCGGGGCTCCGTGGGGTGGTTCCATCAAGGCCATGCGGATCCTGGCCTCAGGTGACAACCAGGGCA TCCCCATCCTGTCCAACATAAAGCTGAAAGAGGAGCAGCGCATAACCACGACTTCCCCCTGGATGCTCCC AGCCCCTCACGTGTGGCCTGAAGACCATGTGTTCATTTCCACACCAAACTTCAACTACACCGTCCAAGAC TTTGAGCGTTTTTTCACAGATCTGCATTTTGAAGAAGGCTGGCACATGTTTCTTCAGTCTCGTGACCTAC TGGAGCGCCTCCCCGCACCTGGTGTAGAAGTATATTGTCTCTACGGTGTGGGCAGACCCACACCCCACAC CTACATCTATGACCACAACTTCCCCTACAAAGACCCCGTGGCTGCACTCTATGAAGATGGGGACGACACC GTAGCCACCCGCAGCACTGAGCTCTGTGGCCAGTGGCAGGGCCGCCAGTCGCAGCCCGTACATTTGCTGC CCATGAACGAGACAGATCACCTCAACATGGTCTTCAGCAATAAGACACTGGAGCATATCAATGCCATCCT ACTGGGTGCCTACCGCACTCCTAAGTCGCCAGCTGCCAGCCCAAGTCCCCCACCCCCTGAATAAAGACCT AGCTGTTATAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008490
Insert Size 1317 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC028861, AAH28861
RefSeq Size 1354 bp
RefSeq ORF 1317 bp
Locus ID 16816
UniProt ID P16301
Cytogenetics 8 53.06 cM
Gene Summary Central enzyme in the extracellular metabolism of plasma lipoproteins. Synthesized mainly in the liver and secreted into plasma where it converts cholesterol and phosphatidylcholines (lecithins) to cholesteryl esters and lysophosphatidylcholines on the surface of high and low density lipoproteins (HDLs and LDLs) (PubMed:19065001). The cholesterol ester is then transported back to the liver. Also produced in the brain by primary astrocytes, and esterifies free cholesterol on nascent APOE-containing lipoproteins secreted from glia and influences cerebral spinal fluid (CSF) APOE- and APOA1 levels (PubMed:19065001). Together with APOE and the cholesterol transporter ABCA1, plays a key role in the maturation of glial-derived, nascent lipoproteins (PubMed:19065001). Required for remodeling high-density lipoprotein particles into their spherical forms (PubMed:19065001). Has a preference for plasma 16:0-18:2 or 18:O-18:2 phosphatidylcholines (PubMed:8820107).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.