Elovl3 (NM_007703) Mouse Untagged Clone

CAT#: MC201113

Elovl3 (untagged) - Mouse elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 (Elovl3), (10ug)


  "NM_007703" in other vectors (3)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Elovl3"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Elovl3
Synonyms Cig30; CIN-2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC016468 sequence for NM_007703
GGCTGGTTAGCAGCGCACGTGCCAGGCTCCGGGGCCCTTCTGCTTATACACAATTTCTTTCTGTCCTGGG TTTCTTCGTCCCTGAGACCCACTCCATCTTCTACTTCTTTGGCTCTCGCCCAGCTCCCTACCCCAAGCTC TGTAACTCGTCGTCTGCAAAATCGAAATGGACACATCCATGAATTTCTCACGCGGGTTAAAAATGGACCT GATGCAACCCTATGACTTCGAGACGTTTCAGGACTTAAGGCCCTTTTTGGAGGAGTACTGGGTAAGCTCA TTTCTCATAGTGGTCGTCTATCTGTTGCTCATCGTTGTTGGCCAGACCTACATGAGAACGCGGAAGAGCT TCAGCTTGCAGAGGCCTCTCATCCTCTGGTCCTTCTTCCTGGCAATATTCAGTATCCTGGGTACTCTGAG GATGTGGAAGTTTATGGCAACAGTGATGTTTACAGTGGGCCTCAAGCAAACCGTGTGCTTTGCCATCTAC ACGGATGACGCCGTAGTCAGATTCTGGTCCTTTCTCTTTCTTCTCAGCAAGGTTGTTGAACTGGGAGACA CGGCCTTCATCATCCTGCGTAAGCGTCCACTCATCTTTGTCCACTGGTACCACCACAGCACAGTGCTACT GTTCACAAGCTTTGGATACAAGAACAAAGTGCCTTCGGGTGGCTGGTTCATGACCATGAACTTTGGCGTC CATTCTGTCATGTACACTTACTACACTATGAAGGCTGCCAAACTGAAGCATCCTAATCTTCTCCCCATGG TCATCACCAGCCTGCAGATTCTGCAGATGGTTCTGGGCACCATCTTTGGCATACTGAATTACATCTGGAG GCAGGAGAAAGGATGCCACACAACAACGGAACACTTCTTCTGGTCTTTTATGCTATATGGGACCTATTTC ATCCTATTCGCTCACTTCTTCCACCGAGCCTACCTCAGGCCCAAGGGCAAAGTTGCATCCAAGAGCCAAT GAGAGTAGGAAAGAAAGATGGAGCCTCAGCCGTTCCTCCGTGGCACTAAGGGTATGGGAGAATGATTAGG GTACCTCCCTGTATGGTTTCCCCCATGGGATATGTACCCTCAAAGTTGCAGGAAGCTATGACAACCAAGA AATGTCACCCTTGGGGATAGGGGGTGTGTGGTTTGGTACTTTGATGTTTCTGTCTTTAATGTGAAGGAAA ACCAAGCCCTAGGAAGGAGATAGGACTGAGGTCCTTAAAATGGAGTTATTTATATTTATATTTAGAAATC TTTCTCTTCTTGCTCTATTTTTAAAAGAGGTCAACATGATCTTGAGGATTTGTGGACTTGGAGGGGAGGG GAGAGTGGACTGACTCTGTGGTAGGAGGAGGCTGACTCTGGGGAGTGAGTGATCTGCAGGGGGGGAGCCT GAGGGTGTGTGGAAGGACAGAGGCACACACAAACACTCAATAAGAATTCTAGGCCTGGTAGGCGCTTAAT AAATGTCTTTTACAGACAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007703
Insert Size 816 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC016468, AAH16468
RefSeq Size 1502 bp
RefSeq ORF 816 bp
Locus ID 12686
UniProt ID O35949
Cytogenetics 19 38.75 cM
Gene Summary Catalyzes the first and rate-limiting reaction of the four reactions that constitute the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process allows the addition of 2 carbons to the chain of long- and very long-chain fatty acids (VLCFAs) per cycle. Condensing enzyme that exhibits activity toward saturated and unsaturated acyl-CoA substrates with higher activity toward C18 acyl-CoAs, especially C18:0 acyl-CoAs. May participate in the production of saturated and monounsaturated VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators. Participates in the formation of certain VLCFA and triglycerides in certain cells of the hair follicles and the sebaceous glands, required for skin barrier function. Critical enzyme for lipid accumulation and metabolic activity in brown adipocytes during the early phase of the tissue recruitment. Plays a role in lipid storage and in resistance to diet-induced obesity.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.