Smpdl3b (NM_133888) Mouse Untagged Clone

CAT#: MC200262

Smpdl3b (untagged) - Mouse sphingomyelin phosphodiesterase, acid-like 3B (Smpdl3b), (10ug)

  View "NM_133888" in other vectors (10)

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Smpdl3b (NM_133888) Mouse Untagged Clone
Symbol Smpdl3b
Synonyms 1110054A24Rik; Asml3b; AU045240
Vector pCMV6-Kan/Neo
Sequence Data
>BC009087 sequence for NM_133888
CTTGGAACACTGGAAGCAGCCAAACGAGTAGTTCTGCCCAGACACGTGGCTGGCCACAAGGTGGGAACCC ACGGCGCAGACGGACTTGGAGGAGCTTCGGCCGCCCGCCGTGGGGGGATCCAGAGGATGACGCTGCTCGG GTGGCTGATATTCCTGGCCCCCTGGGGAGTCGCAGGGGCTCAACTAGGGAGGTTCTGGCACATCTCCGAC CTGCATCTGGACCCCAACTACACCGTATCCAAAGACCCCCTCCAGGTGTGCCCGTCGGCCGGCTCCCAGC CTGTGCTAAATGCTGGCCCCTGGGGGGACTACCTCTGCGATTCTCCTTGGGCCCTTATCAACTCGTCCTT GTATGCCATGAAGGAGATTGAACCAAAGCCTGACTTCATTCTCTGGACAGGGGACGACACACCGCACGTC CCCAATGAGAGTCTAGGAGAGGCAGCTGTGCTGGCAATTGTGGAACGCTTGACCAACCTCATCAAGGAAG TCTTTCCAGACACTAAAGTCTATGCTGCTCTGGGAAATCATGACTTCCACCCTAAGAACCAGTTCCCAGC ACAGAGCAACCGCATCTATAACCAGGTGGCAGAGCTGTGGAGACCCTGGCTTAGTAACGAATCCTACGCT CTCTTCAAAAGAGGTGCCTTCTATTCTGAGAAGTTGCCGGGTCCCAGCAGGGCGGGGCGAGTTGTGGTCC TCAACACCAATCTGTACTACAGCAACAACGAGCAGACAGCTGGCATGGCTGACCCCGGCGAGCAGTTCCG GTGGCTGGGAGATGTCCTGAGCAATGCATCTCGGGATGGGGAGATGGTGTATGTTATTGGCCACGTGCCC CCGGGGTTCTTTGAGAAGACACAGAACAAGGCCTGGTTCCGAGAGAGCTTCAATGAGGAGTATCTGAAGG TGATCCAGAAGCACCATCGGGTCATAGCGGGGCAGTTCTTTGGACACCACCATACCGACAGCTTCCGAAT GTTCTATGACAACACAGGTGCCCCCATAAACGTCATGTTTCTCACACCCGGGGTCACACCGTGGAAGACC ACATTACCTGGAGTGGTCGATGGGGCCAACAATCCAGGGATACGCATTTTCGAGTATGATCGAGCCACAC TCAACTTGAAGGACTTGGTGACTTACTTCTTGAACCTGAGGCAGGCGAATGTACAAGAGACCCCACGGTG GGAGCAGGAGTACCGCCTGACGGAGGCCTACCAGGTGCCGGATGCCAGCGTCAGCTCCATGCACACGGCG CTGACCCGCATTGCCAGTGAGCCTCACATCCTGCAACGTTATTACGTCTATAACTCGGTCAGCTACAACC ATTTGACCTGTGAGGACAGCTGCCGCATCGAGCACGTTTGTGCTATACAACACGTGGCTTTCAACACTTA TGCTACCTGCTTGCATGGTCTTGGTGCCAAGCTGGTGCCTGGTTTCCTGCTCATACTGACTCTGCTGCCA AGCCTGCACGTACTGGAGGTGTTATGACTGTAGGCACTGCCAGCCCACCCACTGACTTGGTTCATCTTTC TCCTGGTAAAATTGGGCAACGTTACCCAATGGAGAGAGATGAACTTTTGCCATCAGTCTCCCCCCGCGGA GAGTAAAGTGGGATGGGACACCTGGATTCACCAGAGAGGGCGCTAAGAAGCACAATTTCTTCCAAGTTTC ATGTTTTATCCACAAAACTTGTTTGCGGTACATGTCTTGGTGCATTATTCGCTTTAATACAAACATATCA AACCACCATGAACTTGATCACCACAGTGAAGTGAGCCGACGGGAAGATGGGCCTTGGAGATTCTGTGCTT TCGATGTAGTCCCTGCTCAAGGTCTGAACTGGGAACGTACGTGGTGTGCAAAACCCCTTAGTACTTTTAA ATAAAAGACTTTTTTGATTTGGTTTTGCAACAGTGAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_133888
ORF Size 1371 bp
Insert Size 1371
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC009087, NP_598649
RefSeq Size 1948
RefSeq ORF 1371
Locus ID 100340
Cytogenetics 4|4 D2.3

Other Versions

Other products for "Smpdl3b"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies