PCBP1 (NM_006196) Human 3' UTR Clone

CAT#: SC205517

3`UTR clone of poly(rC) binding protein 1 (PCBP1) for miRNA target validation

Change vector?

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PCBP1 (NM_006196) Human 3' UTR Clone
Vector pMirTarget
Symbol PCBP1
Synonyms HEL-S-85; hnRNP-E1; hnRNP-X; HNRPE1; HNRPX
ACCN NM_006196
Insert Size 430
Sequence Data
Insert Sequence
>SC205517 3'UTR clone of NM_006196
The sequence shown below is from the reference sequence of NM_006196. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCAATGCCAGGCTTTCCTCTGAGAAGGGCATGGGGTGCAGCTAGAACAGTGTAGGTTCCCTCAATAACCC
CTTTCTGCTGTTCTCCCATGATCCAACTGTGTAATTTCTGGTCAGTGATTCCAGGTTTTAAATAATTTGT
AAGTGTTCAGTTTCTACACAACTTTATCATCCGCTAAGAATTTAAAAATCACATTCTCTGTTCAGCTGTT
AATGCTGGGATCCATATTTAGTTTTATAAGCTTTTCCCTGTTTTTAGTTTTGTTTTGGGTTTTTTGGCTC
ATGAATTTTATTTCTGTTTGTCGATAAGAAATGTAAGAGTGGAATGTTAATAAATTTCAGTTTAGTTCTG
TAATGTCAAGAATTTAAGAATTAAAAAACGGATTGGTTAAAAAATGCTTCATATTTGAAAAAGCTGGGAA
TTGCTGTCTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006196.3
Synonyms HEL-S-85; hnRNP-E1; hnRNP-X; HNRPE1; HNRPX
Summary This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. [provided by RefSeq, Jul 2008].
Locus ID 5093
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations

Documents