TFPI (NM_001032281) Human 3' UTR Clone

CAT#: SC200861

3' UTR clone of tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) (TFPI) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TFPI
• Synonyms: EPI; LACI; TFI; TFPI1
• ACCN: NM_001032281
• Insert Size: 128 bp
• Sequence Data:
  Insert Sequence

  >SC200861 3’UTR clone of NM_001032281
  The sequence shown below is from the reference sequence of NM_001032281. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GGATTGGATAGCATTTCATGCCTATGTTAATATTTGTGCTTTTGGCATTTCCTTAATATTTATATGTAT
  ACGTGATGCCTTTGATAGCATACTGCTAATAAAGTTTTAATATTTACATGCATAGTAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001032281.4
• Summary: This gene encodes a Kunitz-type serine protease inhibitor that regulates the tissue factor (TF)-dependent pathway of blood coagulation. The coagulation process initiates with the formation of a factor VIIa-TF complex, which proteolytically activates additional proteases (factors IX and X) and ultimately leads to the formation of a fibrin clot. The product of this gene inhibits the activated factor X and VIIa-TF proteases in an autoregulatory loop. Inhibition of the encoded protein restores hemostasis in animal models of hemophilia. This gene encodes multiple protein isoforms that differ in their inhibitory activity, specificity and cellular localization. [provided by RefSeq, Jul 2016]
• Locus ID: 7035
• MW: 4.9