pCas-Guide-AAVS1 CRISPR Vector

CAT#: GE100023

AAVS1 gRNA vector, validated AAVS1 targeting sequence cloned in pCas-Guide vector

USD 450.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Features
  • Validated CRISPR vector targeting human AAVS1 site
  • AAVS1 target sequence: GTTAATGTGGCTCTGGTTCT
  • CMV-driven Cas9 and U6-driven AAVS1 gRNA expression
  • Download vector sequence

Applications

  • Targeted transgene insertion via CRISPR when cotransfected with pAAVS1-puro-DNR (after transgene cloned)
  • CRISPR knockin positive control when paired with pAAVS1-RFP-DNR (SKU GE100026)
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents