pCas-Guide-AAVS1

CAT#: GE100023

AAVS1 gRNA vector, validated AAVS1 targeting sequence cloned in pCas-Guide vector


Reconstitution Protocol

USD 650.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CAS9 mouse monoclonal antibody,clone OTI5E5
    • 100 ul

USD 447.00


Purified recombinant protein of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E.coli, sterile-filtered, suitable for cell culture
    • 500 pmol

USD 138.00


Purified recombinant protein of mutant(D10A) of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
    • 500 pmol

USD 152.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Specifications

Product Data
Function All-in-One CRISPR/Cas9 vectors
Features
  • Validated CRISPR vector targeting human AAVS1 site
  • AAVS1 target sequence: GTTAATGTGGCTCTGGTTCT
  • CMV-driven Cas9 and U6-driven AAVS1 gRNA expression

Applications

  • Targeted transgene insertion via CRISPR when cotransfected with pAAVS1-puro-DNR (after transgene cloned)
  • CRISPR knockin positive control when paired with pAAVS1-RFP-DNR (SKU GE100026)

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.