Germany
Japan
United Kingdom
China
CDK5RAP2 Human qPCR Primer Pair (NM_018249)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
USD 305.00
CDK5RAP2 (Myc-DDK-tagged)-Human CDK5 regulatory subunit associated protein 2 (CDK5RAP2), transcript variant 2
USD 1,524.00
Other products for "CDK5RAP2"
Specifications
| Product Data | |
| Gene ID | 55755 |
| Forward Sequence | ACCGATCAACACTGCACTCAGC |
| Reverse Sequence | GGATTGGCAAGCGGGACTTCTT |
| Accession No | BC019577, NM_018249, NM_018249.1, NM_018249.2, NM_018249.4, NM_018249.5, BC019577.1, BC004526, BC136275, BC143732, BC143734, BC143753, BC143755, BC143760, BC143762, BC143764, BC146782, BK005504, BQ428975, BX471011, BX495012, BX537421, BX537708, BX537759, BX640896, BX953708, BX953750, NM_018249.6 |
| UniProt ID | Q96SN8 |
| Synonyms | C48; Cep215; MCPH3 |
| Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.