ZNF331 Human qPCR Primer Pair (NM_018555)

CAT#: HP230871

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene ZNF331

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 55422
Forward Sequence ACTCTGCTCAGAGGGACCTGTA
Reverse Sequence TCCTTTTGGAAGCCCTTATTTCATG
Accession No NM_001079906, NM_001079907, NM_001253798, NM_001253799, NM_001253800, NM_001253801, NM_001317113, NM_001317114, NM_001317115, NM_001317116, NM_001317117, NM_001317118, NM_001317119, NM_001317120, NM_001317121, NM_018555, XM_011527076, XM_011527078, XM_017026936, XM_017026937, XM_017026938, XM_017026939, XM_017026940
Synonyms RITA; ZNF361; ZNF463
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "ZNF331"
Frequently bought together (2)
Rabbit Polyclonal ZNF331 Antibody
    • 100 ug

USD 409.00


ZNF331 (Myc-DDK-tagged)-Human zinc finger protein 331 (ZNF331), transcript variant 1
    • 10 ug

USD 490.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
BOGO Free lysates
68 Mouse Clones