Apc11 (ANAPC11) Human qPCR Primer Pair (NM_016476)

CAT#: HP225697

qSTAR qPCR primer pairs against Homo sapiens gene ANAPC11

Specifications

Product Data

• Gene ID: 51529
• Forward Sequence: GAGAACTGTGGCATCTGCAGGA
• Reverse Sequence: CAGCCACTTGAGGATGCAATGC
• Accession No: BC000607, NM_016476, NM_016476.1, NM_016476.10, NM_016476.11, NM_016476.2, NM_016476.3, NM_016476.4, NM_016476.5, NM_016476.6, NM_016476.7, NM_016476.8, NM_016476.9, BC000607.1, BC066308, BC095454, BC104641, BC171892, BC171898, BC171899, BC171900, BF435042, BF512771, BG707824, BM762129, BM845909, BU554167, BU556841, BY796995
• UniProt ID: Q9NYG5
• Synonyms: APC11; Apc11p; HSPC214
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.