Apc11 (ANAPC11) Human qPCR Primer Pair (NM_016476)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
ANAPC11 (Myc-DDK-tagged)-Human anaphase promoting complex subunit 11 (ANAPC11), transcript variant 1
USD 300.00
Other products for "ANAPC11"
Specifications
Product Data | |
Gene ID | 51529 |
Forward Sequence | GAGAACTGTGGCATCTGCAGGA |
Reverse Sequence | CAGCCACTTGAGGATGCAATGC |
Accession No | BC000607, NM_016476, NM_016476.1, NM_016476.10, NM_016476.11, NM_016476.2, NM_016476.3, NM_016476.4, NM_016476.5, NM_016476.6, NM_016476.7, NM_016476.8, NM_016476.9, BC000607.1, BC066308, BC095454, BC104641, BC171892, BC171898, BC171899, BC171900, BF435042, BF512771, BG707824, BM762129, BM845909, BU554167, BU556841, BY796995 |
UniProt ID | Q9NYG5 |
Synonyms | APC11; Apc11p; HSPC214 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.