CDH10 Human qPCR Primer Pair (NM_006727)

CAT#: HP209618

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene CDH10

USD 100.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 1008
Forward Sequence GACAACCACTGTGAACATCACGC
Reverse Sequence TGACACTTCCAATGGCTGTGCC
Accession No NM_001190450, NM_006727, XM_011513923, XM_017008915
Synonyms T2-cadherin; cadherin 10, type 2; cadherin-10; cadherin 10, type 2 (T2-cadherin)
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "CDH10"
Frequently bought together (1)
CDH10 (Myc-DDK-tagged)-Human cadherin 10, type 2 (T2-cadherin) (CDH10)
    • 10 ug

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones