Estrogen Related Receptor gamma (ESRRG) Human qPCR Primer Pair (NM_001438)

CAT#: HP205318

qSTAR qPCR primer pairs against Homo sapiens gene ESRRG

Specifications

Product Data

• Gene ID: 2104
• Forward Sequence: CGCAGGATAGATGCGGAGAACA
• Reverse Sequence: TTCAGCCACCAACAAATGTGAGAC
• Accession No: NM_001438, NM_001438.1, NM_001438.2, NM_001438.3, BC008218, BC064700, BM723962, BP349857, BU752915, BX486063, BX647076, BX649009, NM_001438.4
• UniProt ID: P62508
• Synonyms: ERR-gamma; ERR3; ERRg; ERRgamma; NR3B3
• Component: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.