PI 3 Kinase catalytic subunit gamma (PIK3CG) (NM_001282426) Human Untagged Clone

CAT#: SC337859

Reviews ()
Write a review

PIK3CG (untagged) - Human phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma (PIK3CG), transcript variant 2

  View "NM_001282426" in other vectors (1)

USD 1,110.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name PI 3 Kinase catalytic subunit gamma (PIK3CG) (NM_001282426) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol PIK3CG
Synonyms p110gamma; p120-PI3K; PI3CG; PI3K; PI3Kgamma; PIK3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001282426, the custom clone sequence may differ by one or more nucleotides


ATGGAGCTGGAGAACTATAAACAGCCCGTGGTGCTGAGAGAGGACAACTGCCGAAGGCGCCGGAGGATGA
AGCCGCGCAGTGCTGCGGCCAGCCTGTCCTCCATGGAGCTCATCCCCATCGAGTTCGTGCTGCCCACCAG
CCAGCGCAAATGCAAGAGCCCCGAAACGGCGCTGCTGCACGTGGCCGGCCACGGCAACGTGGAGCAGATG
AAGGCCCAGGTGTGGCTGCGAGCGCTGGAGACCAGCGTGGCGGCGGACTTCTACCACCGGCTGGGACCGC
ATCACTTCCTCCTGCTCTATCAGAAGAAGGGGCAGTGGTACGAGATCTACGACAAGTACCAGGTGGTGCA
GACTCTGGACTGCCTGCGCTACTGGAAGGCCACGCACCGGAGCCCGGGCCAGATCCACCTGGTGCAGCGG
CACCCGCCCTCCGAGGAGTCCCAAGCCTTCCAGCGGCAGCTCACGGCGCTGATTGGCTATGACGTCACTG
ACGTCAGCAACGTGCACGACGATGAGCTGGAGTTCACGCGCCGTGGCTTGGTGACCCCGCGCATGGCGGA
GGTGGCCAGCCGCGACCCCAAGCTCTACGCCATGCACCCGTGGGTGACGTCCAAGCCCCTCCCGGAGTAC
CTGTGGAAGAAGATTGCCAACAACTGCATCTTCATCGTCATTCACCGCAGCACCACCAGCCAGACCATTA
AGGTCTCACCCGACGACACCCCCGGCGCCATCCTGCAGAGCTTCTTCACCAAGATGGCCAAGAAGAAATC
TCTGATGGATATTCCCGAAAGCCAAAGCGAACAGGATTTTGTGCTGCGCGTCTGTGGCCGGGATGAGTAC
CTGGTGGGCGAAACGCCCATCAAAAACTTCCAGTGGGTGAGGCACTGCCTCAAGAACGGAGAAGAGATTC
ACGTGGTACTGGACACGCCTCCAGACCCGGCCCTAGACGAGGTGAGGAAGGAAGAGTGGCCACTGGTGGA
TGACTGCACGGGAGTCACCGGCTACCATGAGCAGCTTACCATCCACGGCAAGGACCACGAGAGTGTGTTC
ACCGTGTCCCTGTGGGACTGCGACCGCAAGTTCAGGGTCAAGATCAGAGGCATTGATATCCCCGTCCTGC
CTCGGAACACCGACCTCACAGTTTTTGTAGAGGCAAACATCCAGCATGGGCAACAAGTCCTTTGCCAAAG
GAGAACCAGCCCCAAACCCTTCACAGAGGAGGTGCTGTGGAATGTGTGGCTTGAGTTCAGTATCAAAATC
AAAGACTTGCCCAAAGGGGCTCTACTGAACCTCCAGATCTACTGCGGTAAAGCTCCAGCACTGTCCAGCA
AGGCCTCTGCAGAGTCCCCCAGTTCTGAGTCCAAGGGCAAAGTTCAGCTTCTCTATTATGTGAACCTGCT
GCTGATAGACCACCGTTTCCTCCTGCGCCGTGGAGAATACGTCCTCCACATGTGGCAGATATCTGGGAAG
GGAGAAGACCAAGGAAGCTTCAATGCTGACAAACTCACGTCTGCAACTAACCCAGACAAGGAGAACTCAA
TGTCCATCTCCATTCTTCTGGACAATTACTGCCACCCGATAGCCCTGCCTAAGCATCAGCCCACCCCTGA
CCCGGAAGGGGACCGGGTTCGAGCAGAAATGCCCAACCAGCTTCGCAAGCAATTGGAGGCGATCATAGCC
ACTGATCCACTTAACCCTCTCACAGCAGAGGACAAAGAATTGCTCTGGCATTTTAGATACGAAAGCCTTA
AGCACCCAAAAGCATATCCTAAGCTATTTAGTTCAGTGAAATGGGGACAGCAAGAAATTGTGGCCAAAAC
ATACCAATTGTTGGCCAGAAGGGAAGTCTGGGATCAAAGTGCTTTGGATGTTGGGTTAACAATGCAGCTC
CTGGACTGCAACTTCTCAGATGAAAATGTAAGAGCCATTGCAGTTCAGAAACTGGAGAGCTTGGAGGACG
ATGATGTTCTGCATTACCTTCTACAATTGGTCCAGGCTGTGAAATTTGAACCATACCATGATAGCGCCCT
TGCCAGATTTCTGCTGAAGCGTGGTTTAAGAAACAAAAGAATTGGTCACTTTTTGTTTTGGTTCTTGAGA
AGTGAGATAGCCCAGTCCAGACACTATCAGCAGAGGTTCGCTGTGATTCTGGAAGCCTATCTGAGGGGCT
GTGGCACAGCCATGCTGCACGACTTTACCCAACAAGTCCAAGTAATCGAGATGTTACAAAAAGTCACCCT
TGATATTAAATCGCTCTCTGCTGAAAAGTATGACGTCAGTTCCCAAGTTATTTCACAACTTAAACAAAAG
CTTGAAAACCTGCAGAATTCTCAACTCCCCGAAAGCTTTAGAGTTCCATATGATCCTGGACTGAAAGCAG
GAGCGCTGGCAATTGAAAAATGTAAAGTAATGGCCTCCAAGAAAAAACCACTATGGCTTGAGTTTAAATG
TGCCGATCCTACAGCCCTATCAAATGAAACAATTGGAATTATCTTTAAACATGGTGATGATCTGCGCCAA
GACATGCTTATTTTACAGATTCTACGAATCATGGAGTCTATTTGGGAGACTGAATCTTTGGATCTATGCC
TCCTGCCATATGGTTGCATTTCAACTGGTGACAAAATAGGAATGATCGAGATTGTGAAAGACGCCACGAC
AATTGCCAAAATTCAGCAAAGCACAGTGGGCAACACGGGAGCATTTAAAGATGAAGTCCTGAATCACTGG
CTCAAAGAAAAATCCCCTACTGAAGAAAAGTTTCAGGCAGCAGTGGAGAGATTTGTTTATTCCTGTGCAG
GCTACTGTGTGGCAACCTTTGTTCTTGGAATAGGCGACAGACACAATGACAATATTATGATCACCGAGAC
AGGAAACCTATTTCATATTGACTTCGGGCACATTCTTGGGAATTACAAAAGTTTCCTGGGCATTAATAAA
GAGAGAGTGCCATTTGTGCTAACCCCTGACTTCCTCTTTGTGATGGGAACTTCTGGAAAGAAGACAAGCC
CACACTTCCAGAAATTTCAGGACATCTGTGTTAAGGCTTATCTAGCCCTTCGTCATCACACAAACCTACT
GATCATCCTGTTCTCCATGATGCTGATGACAGGAATGCCCCAGTTAACAAGCAAAGAAGACATTGAATAT
ATCCGGGATGCCCTCACAGTGGGGAAAAATGAGGAGGATGCTAAAAAGTATTTTCTTGATCAGATCGAAG
TTTGCAGAGACAAAGGATGGACTGTGCAGTTTAATTGGTTTCTACATCTTGTTCTTGGCATCAAACAAGG
AGAGAAACATTCAGCCTAA


Restriction Sites SgfI-MluI     
Tag Tag Free
ACCN NM_001282426
ORF Size 3309 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001282426.1, NP_001269355.1
RefSeq Size 7069
RefSeq ORF 3309
Locus ID 5294
Cytogenetics 7q22.3
Protein Families Druggable Genome, ES Cell Differentiation/IPS
Protein Pathways Acute myeloid leukemia, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Inositol phosphate metabolism, Insulin signaling pathway, Jak-STAT signaling pathway, Leukocyte transendothelial migration, Melanoma, mTOR signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Phosphatidylinositol signaling system, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, VEGF signaling pathway
Gene Summary Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All three variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

Other products for "PIK3CG"
Frequently bought together (2)
PIK3CG mouse monoclonal antibody,clone OTI4G10
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones