G protein alpha inhibitor 1 (GNAI1) (NM_002069) Human Untagged Clone
CAT#: SC309030
GNAI1 (untagged)-Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1)
"NM_002069" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | G protein alpha inhibitor 1 |
Synonyms | Gi |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_002069 edited
ATGGGCTGCACGCTGAGCGCCGAGGACAAGGCGGCGGTGGAGCGGAGTAAGATGATCGAC CGCAACCTCCGTGAGGACGGCGAGAAGGCGGCGCGCGAGGTCAAGCTGCTGCTGCTCGGT GCTGGTGAATCTGGTAAAAGTACAATTGTGAAGCAGATGAAAATTATCCATGAAGCTGGT TATTCAGAAGAGGAGTGTAAACAATACAAAGCAGTGGTCTACAGTAACACCATCCAGTCA ATTATTGCTATCATTAGGGCTATGGGGAGGTTGAAGATAGACTTTGGTGACTCAGCCCGG GCGGATGATGCACGCCAACTCTTTGTGCTAGCTGGAGCTGCTGAAGAAGGCTTTATGACT GCAGAACTTGCTGGAGTTATAAAGAGATTGTGGAAAGATAGTGGTGTACAAGCCTGTTTC AACAGATCCCGAGAGTACCAGCTTAATGATTCTGCAGCATACTATTTGAATGACTTGGAC AGAATAGCTCAACCAAATTACATCCCGACTCAACAAGATGTTCTCAGAACTAGAGTGAAA ACTACAGGAATTGTTGAAACCCATTTTACTTTCAAAGATCTTCATTTTAAAATGTTTGAT GTGGGAGGTCAGAGATCTGAGCGGAAGAAGTGGATTCATTGCTTCGAAGGAGTGACGGCG ATCATCTTCTGTGTAGCACTGAGTGACTACGACCTGGTTCTAGCTGAAGATGAAGAAATG AACCGAATGCATGAAAGCATGAAATTGTTTGACAGCATATGTAACAACAAGTGGTTTACA GATACATCCATTATACTTTTTCTAAACAAGAAGGATCTCTTTGAAGAAAAAATCAAAAAG AGCCCTCTCACTATATGCTATCCAGAATATGCAGGATCAAACACATATGAAGAGGCAGCT GCATATATTCAATGTCAGTTTGAAGACCTCAATAAAAGAAAGGACACAAAGGAAATATAC ACCCACTTCACATGTGCCACAGATACTAAGAATGTGCAGTTTGTTTTTGATGCTGTAACA GATGTCATCATAAAAAATAATCTAAAAGATTGTGGTCTCTTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_002069 |
Insert Size | 2300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_002069.5. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002069.4, NP_002060.4 |
RefSeq Size | 3342 bp |
RefSeq ORF | 1065 bp |
Locus ID | 2770 |
UniProt ID | P63096 |
Cytogenetics | 7q21.11 |
Domains | G-alpha |
Protein Families | Druggable Genome |
Protein Pathways | Axon guidance, Chemokine signaling pathway, Gap junction, Leukocyte transendothelial migration, Long-term depression, Melanogenesis, Progesterone-mediated oocyte maturation, Tight junction |
Gene Summary | Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205289 | GNAI1 (Myc-DDK-tagged)-Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1) |
USD 457.00 |
|
RC205289L1 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), Myc-DDK-tagged |
USD 757.00 |
|
RC205289L2 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), mGFP tagged |
USD 757.00 |
|
RC205289L3 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), Myc-DDK-tagged |
USD 757.00 |
|
RC205289L4 | Lenti ORF clone of Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1), mGFP tagged |
USD 757.00 |
|
RG205289 | GNAI1 (tGFP-tagged) - Human guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 (GNAI1) |
USD 657.00 |
{0} Product Review(s)
Be the first one to submit a review