Fibronectin(FN1) (NM_212482) Human Untagged Clone

CAT#: SC308640

FN1 (untagged)-Human fibronectin 1 (FN1), transcript variant 1

USD 4,728


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Fibronectin(FN1) (NM_212482) Human Untagged Clone
Symbol FN1
Synonyms CIG; ED-B; FINC; FN; FNZ; GFND; GFND2; LETS; MSF
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_212482 edited
CGGCTGTGCTGCACAGGGGGAGGAGAGGGAACCCCAGGCGCGAGCGGGAAGAGGGGACCT
GCAGCCACAACTTCTCTGGTCCTCTGCATCCCTTCTGTCCCTCCACCCGTCCCCTTCCCC
ACCCTCTGGCCCCCACCTTCTTGGAGGCGACAACCCCCGGGAGGCATTAGAAGGGATTTT
TCCCGCAGGTTGCGAAGGGAAGCAAACTTGGTGGCAACTTGCCTCCCGGTGCGGGCGTCT
CTCCCCCACCGTCTCAACATGCTTAGGGGTCCGGGGCCCGGGCTGCTGCTGCTGGCCGTC
CTGTGCCTGGGGACAGCGGTGCCCTCCACGGGAGCCTCGAAGAGCAAGAGGCAGGCTCAG
CAAATGGTTCAGCCCCAGTCCCCGGTGGCTGTCAGTCAAAGCAAGCCCGGTTGTTATGAC
AATGGAAAACACTATCAGATAAATCAACAGTGGGAGCGGACCTACCTAGGCAATGCGTTG
GTTTGTACTTGTTATGGAGGAAGCCGAGGTTTTAACTGCGAGAGTAAACCTGAAGCTGAA
GAGACTTGCTTTGACAAGTACACTGGGAACACTTACCGAGTGGGTGACACTTATGAGCGT
CCTAAAGACTCCATGATCTGGGACTGTACCTGCATCGGGGCTGGGCGAGGGAGAATAAGC
TGTACCATCGCAAACCGCTGCCATGAAGGGGGTCAGTCCTACAAGATTGGTGACACCTGG
AGGAGACCACATGAGACTGGTGGTTACATGTTAGAGTGTGTGTGTCTTGGTAATGGAAAA
GGAGAATGGACCTGCAAGCCCATAGCTGAGAAGTGTTTTGATCATGCTGCTGGGACTTCC
TATGTGGTCGGAGAAACGTGGGAGAAGCCCTACCAAGGCTGGATGATGGTAGATTGTACT
TGCCTGGGAGAAGGCAGCGGACGCATCACTTGCACTTCTAGAAATAGATGCAACGATCAG
GACACAAGGACATCCTATAGAATTGGAGACACCTGGAGCAAGAAGGATAATCGAGGAAAC
CTGCTCCAGTGCATCTGCACAGGCAACGGCCGAGGAGAGTGGAAGTGTGAGAGGCACACC
TCTGTGCAGACCACATCGAGCGGATCTGGCCCCTTCACCGATGTTCGTGCAGCTGTTTAC
CAACCGCAGCCTCACCCCCAGCCTCCTCCCTATGGCCACTGTGTCACAGACAGTGGTGTG
GTCTACTCTGTGGGGATGCAGTGGCTGAAGACACAAGGAAATAAGCAAATGCTTTGCACG
TGCCTGGGCAACGGAGTCAGCTGCCAAGAGACAGCTGTAACCCAGACTTACGGTGGCAAC
TCAAATGGAGAGCCATGTGTCTTACCATTCACCTACAATGGCAGGACGTTCTACTCCTGC
ACCACAGAAGGGCGACAGGACGGACATCTTTGGTGCAGCACAACTTCGAATTATGAGCAG
GACCAGAAATACTCTTTCTGCACAGACCACACTGTTTTGGTTCAGACTCGAGGAGGAAAT
TCCAATGGTGCCTTGTGCCACTTCCCCTTCCTATACAACAACCACAATTACACTGATTGC
ACTTCTGAGGGCAGAAGAGACAACATGAAGTGGTGTGGGACCACACAGAACTATGATGCC
GACCAGAAGTTTGGGTTCTGCCCCATGGCTGCCCACGAGGAAATCTGCACAACCAATGAA
GGGGTCATGTACCGCATTGGAGATCAGTGGGATAAGCAGCATGACATGGGTCACATGATG
AGGTGCACGTGTGTTGGGAATGGTCGTGGGGAATGGACATGCATTGCCTACTCGCAGCTT
CGAGATCAGTGCATTGTTGATGACATCACTTACAATGTGAACGACACATTCCACAAGCGT
CATGAAGAGGGGCACATGCTGAACTGTACATGCTTCGGTCAGGGTCGGGGCAGGTGGAAG
TGTGATCCCGTCGACCAATGCCAGGATTCAGAGACTGGGACGTTTTATCAAATTGGAGAT
TCATGGGAGAAGTATGTGCATGGTGTCAGATACCAGTGCTACTGCTATGGCCGTGGCATT
GGGGAGTGGCATTGCCAACCTTTACAGACCTATCCAAGCTCAAGTGGTCCTGTCGAAGTA
TTTATCACTGAGACTCCGAGTCAGCCCAACTCCCACCCCATCCAGTGGAATGCACCACAG
CCATCTCACATTTCCAAGTACATTCTCAGGTGGAGACCTAAAAATTCTGTAGGCCGTTGG
AAGGAAGCTACCATACCAGGCCACTTAAACTCCTACACCATCAAAGGCCTGAAGCCTGGT
GTGGTATACGAGGGCCAGCTCATCAGCATCCAGCAGTACGGCCACCAAGAAGTGACTCGC
TTTGACTTCACCACCACCAGCACCAGCACACCTGTGACCAGCAACACCGTGACAGGAGAG
ACGACTCCCTTTTCTCCTCTTGTGGCCACTTCTGAATCTGTGACCGAAATCACAGCCAGT
AGCTTTGTGGTCTCCTGGGTCTCAGCTTCCGACACCGTGTCGGGATTCCGGGTGGAATAT
GAGCTGAGTGAGGAGGGAGATGAGCCACAGTACCTGGATCTTCCAAGCACAGCCACTTCT
GTGAACATCCCTGACCTGCTTCCTGGCCGAAAATACATTGTAAATGTCTATCAGATATCT
GAGGATGGGGAGCAGAGTTTGATCCTGTCTACTTCACAAACAACAGCGCCTGATGCCCCA
CCTGACCCGACTGTGGACCAAGTTGATGACACCTCAATTGTTGTTCGCTGGAGCAGACCC
CAGGCTCCCATCACAGGGTACAGAATAGTCTATTCGCCATCAGTAGAAGGTAGCAGCACA
GAACTCAACCTTCCTGAAACTGCAAACTCCGTCACCCTCAGTGACTTGCAACCTGGTGTT
CAGTATAACATCACTATCTATGCTGTGGAAGAAAATCAAGAAAGTACACCTGTTGTCATT
CAACAAGAAACCACTGGCACCCCACGCTCAGATACAGTGCCCTCTCCCAGGGACCTGCAG
TTTGTGGAAGTGACAGACGTGAAGGTCACCATCATGTGGACACCGCCTGAGAGTGCAGTG
ACCGGCTACCGTGTGGATGTGATCCCCGTCAACCTGCCTGGCGAGCACGGGCAGAGGCTG
CCCATCAGCAGGAACACCTTTGCAGAAGTCACCGGGCTGTCCCCTGGGGTCACCTATTAC
TTCAAAGTCTTTGCAGTGAGCCATGGGAGGGAGAGCAAGCCTCTGACTGCTCAACAGACA
ACCAAACTGGATGCTCCCACTAACCTCCAGTTTGTCAATGAAACTGATTCTACTGTCCTG
GTGAGATGGACTCCACCTCGGGCCCAGATAACAGGATACCGACTGACCGTGGGCCTTACC
CGAAGAGGACAGCCCAGGCAGTACAATGTGGGTCCCTCTGTCTCCAAGTACCCACTGAGG
AATCTGCAGCCTGCATCTGAGTACACCGTATCCCTCGTGGCCATAAAGGGCAACCAAGAG
AGCCCCAAAGCCACTGGAGTCTTTACCACACTGCAGCCTGGGAGCTCTATTCCACCTTAC
AACACCGAGGTGACTGAGACCACCATTGTGATCACATGGACGCCTGCTCCAAGAATTGGT
TTTAAGCTGGGTGTACGACTAAGCCAGGGAGGAGAGGCACCACGAGAAGTGACTTCAGAC
TCAGGAAGCATCGTTGTGTCCGGCTTGACTCCAGGAGTAGAATACGTCTACACCATCCAA
GTCCTGAGAGATGGACAGGAAAGAGATGCGCCAATTGTAAACAAAGTGGTGACACCATTG
TCTCCACCAACAAACTTGCATCTGGAGGCAAACCCTGACACTGGAGTGCTCACAGTCTCC
TGGGAGAGGAGCACCACCCCAGACATTACTGGTTATAGAATTACCACAACCCCTACAAAC
GGCCAGCAGGGAAATTCTTTGGAAGAAGTGGTCCATGCTGATCAGAGCTCCTGCACTTTT
GATAACCTGAGTCCCGGCCTGGAGTACAATGTCAGTGTTTACACTGTCAAGGATGACAAG
GAAAGTGTCCCTATCTCTGATACCATCATCCCAGAGGTGCCCCAACTCACTGACCTAAGC
TTTGTTGATATAACCGATTCAAGCATCGGCCTGAGGTGGACCCCGCTAAACTCTTCCACC
ATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATTTTTGAAGAT
TTTGTGGACTCCTCAGTAGGATACTACACAGTCACAGGGCTGGAGCCGGGCATTGACTAT
GATATCAGCGTTATCACTCTCATTAATGGCGGCGAGAGTGCCCCTACTACACTGACACAA
CAAACGGCTGTTCCTCCTCCCACTGACCTGCGATTCACCAACATTGGTCCAGACACCATG
CGTGTCACCTGGGCTCCACCCCCATCCATTGATTTAACCAACTTCCTGGTGCGTTACTCA
CCTGTGAAAAATGAGGAAGATGTTGCAGAGTTGTCAATTTCTCCTTCAGACAATGCAGTG
GTCTTAACAAATCTCCTGCCTGGTACAGAATATGTAGTGAGTGTCTCCAGTGTCTACGAA
CAACATGAGAGCACACCTCTTAGAGGAAGACAGAAAACAGGTCTTGATTCCCCAACTGGC
ATTGACTTTTCTGATATTACTGCCAACTCTTTTACTGTGCACTGGATTGCTCCTCGAGCC
ACCATCACTGGCTACAGGATCCGCCATCATCCCGAGCACTTCAGTGGGAGACCTCGAGAA
GATCGGGTGCCCCACTCTCGGAATTCCATCACCCTCACCAACCTCACTCCAGGCACAGAG
TATGTGGTCAGCATCGTTGCTCTTAATGGCAGAGAGGAAAGTCCCTTATTGATTGGCCAA
CAATCAACAGTTTCTGATGTTCCGAGGGACCTGGAAGTTGTTGCTGCGACCCCCACCAGC
CTACTGATCAGCTGGGATGCTCCTGCTGTCACAGTGAGATATTACAGGATCACTTACGGA
GAAACAGGAGGAAATAGCCCTGTCCAGGAGTTCACTGTGCCTGGGAGCAAGTCTACAGCT
ACCATCAGCGGCCTTAAACCTGGAGTTGATTATACCATCACTGTGTATGCTGTCACTGGC
CGTGGAGACAGCCCCGCAAGCAGCAAGCCAATTTCCATTAATTACCGAACAGAAATTGAC
AAACCATCCCAGATGCAAGTGACCGATGTTCAGGACAACAGCATTAGTGTCAAGTGGCTG
CCTTCAAGTTCCCCTGTTACTGGTTACAGAGTAACCACCACTCCCAAAAATGGACCAGGA
CCAACAAAAACTAAAACTGCAGGTCCAGATCAAACAGAAATGACTATTGAAGGCTTGCAG
CCCACAGTGGAGTATGTGGTTAGTGTCTATGCTCAGAATCCAAGCGGAGAGAGTCAGCCT
CTGGTTCAGACTGCAGTAACCAACATTGATCGCCCTAAAGGACTGGCATTCACTGATGTG
GATGTCGATTCCATCAAAATTGCTTGGGAAAGCCCACAGGGGCAAGTTTCCAGGTACAGG
GTGACCTACTCGAGCCCTGAGGATGGAATCCATGAGCTATTCCCTGCACCTGATGGTGAA
GAAGACACTGCAGAGCTGCAAGGCCTCAGACCGGGTTCTGAGTACACAGTCAGTGTGGTT
GCCTTGCACGATGATATGGAGAGCCAGCCCCTGATTGGAACCCAGTCCACAGCTATTCCT
GCACCAACTGACCTGAAGTTCACTCAGGTCACACCCACAAGCCTGAGCGCCCAGTGGACA
CCACCCAATGTTCAGCTCACTGGATATCGAGTGCGGGTGACCCCCAAGGAGAAGACCGGA
CCAATGAAAGAAATCAACCTTGCTCCTGACAGCTCATCCGTGGTTGTATCAGGACTTATG
GTGGCCACCAAATATGAAGTGAGTGTCTATGCTCTTAAGGACACTTTGACAAGCAGACCA
GCTCAGGGTGTTGTCACCACTCTGGAGAATGTCAGCCCACCAAGAAGGGCTCGTGTGACA
GATGCTACTGAGACCACCATCACCATTAGCTGGAGAACCAAGACTGAGACGATCACTGGC
TTCCAAGTTGATGCCGTTCCAGCCAATGGCCAGACTCCAATCCAGAGAACCATCAAGCCA
GATGTCAGAAGCTACACCATCACAGGTTTACAACCAGGCACTGACTACAAGATCTACCTG
TACACCTTGAATGACAATGCTCGGAGCTCCCCTGTGGTCATCGACGCCTCCACTGCCATT
GATGCACCATCCAACCTGCGTTTCCTGGCCACCACACCCAATTCCTTGCTGGTATCATGG
CAGCCGCCACGTGCCAGGATTACCGGCTACATCATCAAGTATGAGAAGCCTGGGTCTCCT
CCCAGAGAAGTGGTCCCTCGGCCCCGCCCTGGTGTCACAGAGGCTACTATTACTGGCCTG
GAACCGGGAACCGAATATACAATTTATGTCATTGCCCTGAAGAATAATCAGAAGAGCGAG
CCCCTGATTGGAAGGAAAAAGACAGACGAGCTTCCCCAACTGGTAACCCTTCCACACCCC
AATCTTCATGGACCAGAGATCTTGGATGTTCCTTCCACAGTTCAAAAGACCCCTTTCGTC
ACCCACCCTGGGTATGACACTGGAAATGGTATTCAGCTTCCTGGCACTTCTGGTCAGCAA
CCCAGTGTTGGGCAACAAATGATCTTTGAGGAACATGGTTTTAGGCGGACCACACCGCCC
ACAACGGCCACCCCCATAAGGCATAGGCCAAGACCATACCCGCCGAATGTAGGTGAGGAA
ATCCAAATTGGTCACATCCCCAGGGAAGATGTAGACTATCACCTGTACCCACACGGTCCG
GGACTCAATCCAAATGCCTCTACAGGACAAGAAGCTCTCTCTCAGACAACCATCTCATGG
GCCCCATTCCAGGACACTTCTGAGTACATCATTTCATGTCATCCTGTTGGCACTGATGAA
GAACCCTTACAGTTCAGGGTTCCTGGAACTTCTACCAGTGCCACTCTGACAGGCCTCACC
AGAGGTGCCACCTACAACATCATAGTGGAGGCACTGAAAGACCAGCAGAGGCATAAGGTT
CGGGAAGAGGTTGTTACCGTGGGCAACTCTGTCAACGAAGGCTTGAACCAACCTACGGAT
GACTCGTGCTTTGACCCCTACACAGTTTCCCATTATGCCGTTGGAGATGAGTGGGAACGA
ATGTCTGAATCAGGCTTTAAACTGTTGTGCCAGTGCTTAGGCTTTGGAAGTGGTCATTTC
AGATGTGATTCATCTAGATGGTGCCATGACAATGGTGTGAACTACAAGATTGGAGAGAAG
TGGGACCGTCAGGGAGAAAATGGCCAGATGATGAGCTGCACATGTCTTGGGAACGGAAAA
GGAGAATTCAAGTGTGACCCTCATGAGGCAACGTGTTATGATGATGGGAAGACATACCAC
GTAGGAGAACAGTGGCAGAAGGAATATCTCGGTGCCATTTGCTCCTGCACATGCTTTGGA
GGCCAGCGGGGCTGGCGCTGTGACAACTGCCGCAGACCTGGGGGTGAACCCAGTCCCGAA
GGCACTACTGGCCAGTCCTACAACCAGTATTCTCAGAGATACCATCAGAGAACAAACACT
AATGTTAATTGCCCAATTGAGTGCTTCATGCCTTTAGATGTACAGGCTGACAGAGAAGAT
TCCCGAGAGTAAATCATCTTTCCAATCCAGAGGAACAAGCATGTCTCTCTGCCAAGATCC
ATCTAAACTGGAGTGATGTTAGCAGACCCAGCTTAGAGTTCTTCTTTCTTTCTTAAGCCC
TTTGCTCTGGAGGAAGTTCTCCAGCTTCAGCTCAACTCACAGCTTCTCCAAGCATCACCC
TGGGAGTTTCCTGAGGGTTTTCTCATAAATGAGGGCTGCACATTGCCTGTTCTGCTTCGA
AGTATTCAATACCGCTCAGTATTTTAAATGAAGTGATTCTAAGATTTGGTTTGGGATCAA
TAGGAAAGCATATGCAGCCAACCAAGATGCAAATGTTTTGAAATGATATGACCAAAATTT
TAAGTAGGAAAGTCACCCAAACACTTCTGCTTTCACTTAAGTGTCTGGCCCGCAATACTG
TAGGAACAAGCATGATCTTGTTACTGTGATATTTTAAATATCCACAGTACTCACTTTTTC
CAAATGATCCTAGTAATTGCCTAGAAATATCTTTCTCTTACCTGTTATTTATCAATTTTT
CCCAGTATTTTTATACGGAAAAAATTGTATTGAAAACACTTAGTATGCAGTTGATAAGAG
GAATTTGGTATAATTATGGTGGGTGATTATTTTTTATACTGTATGTGCC
Tag Tag Free
ACCN NM_212482
ORF Size 7434 bp
Insert Size 8300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The full length of MG2604_G07 was sequenced, and the DNA sequence matches with that of NM_212482.1. There are SNPs in ORF.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_212482.1, NP_997647
RefSeq Size 8815
RefSeq ORF 7434
Locus ID 2335
Cytogenetics 2q35
Protein Families Secreted Protein, ES Cell Differentiation/IPS, Druggable Genome
Protein Pathways Focal adhesion, ECM-receptor interaction, Regulation of actin cytoskeleton, Pathways in cancer, Small cell lung cancer
Gene Summary This gene encodes fibronectin, a glycoprotein present in a soluble dimeric form in plasma, and in a dimeric or multimeric form at the cell surface and in extracellular matrix. The encoded preproprotein is proteolytically processed to generate the mature protein. Fibronectin is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. The gene has three regions subject to alternative splicing, with the potential to produce 20 different transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. The full-length nature of some variants has not been determined. [provided by RefSeq, Jan 2016].
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). The encoded isoform (1) may undergo proteolytic processing similar to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.