Interferon gamma(IFNG) (NM_000619) Human Untagged Clone

CAT#: SC300109

IFNG (untagged)-Human interferon, gamma (IFNG)

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Interferon gamma(IFNG) (NM_000619) Human Untagged Clone
Symbol IFNG
Synonyms IFG; IFI
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000619 edited
AAACGATGAAATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTC
TTGGCTGTTACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTA
ATGCAGGTCATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATT
GGAAAGAGGAGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAAC
TTTTTAAAAACTTTAAAGATGACCAGAGCATCCAAAAGAGTGTGGAGACCATCAAGGAAG
ACATGAATGTCAAGTTTTTCAATAGCAACAAAAAGAAACGAGATGACTTCGAAAAGCTGA
CTAATTATTCGGTAACTGACTTGAATGTCCAACGCAAAGCAATACATGAACTCATCCAAG
TGATGGCTGAACTGTCGCCAGCAGCTAAAACAGGGAAGCGAAAAAGGAGTCAGATGCTGT
TTCGAGGTCGAAGAGCATCCCAGTAATGGTTGTCCTGCCTGCAATATTTGAATTTTAAAT
CTAAATCTATTTATTAATATTTAACATTATTTATATGGGGAATATATTTTTAGACTCATC
AATCAAATAAGTATTTATAATAGCAACTTTTGTGTAATGAAAATGAATATCTATTAATAT
ATGTATTATTTATAATTCCTATATCCTGTGACTGTCTCACTTAATCCTTTGTTTTCTGAC
TAATTAGGCAAGGCTATGTGATTACAAGGCTTTATCTCAGGGGCCAACTAGGCAGCCAAC
CTAAGCAAGATCCCATGGGTTGTGTGTTTATTTCACTTGATGATACAATGAACACTTATA
AGTGAAGTGATACTATCCAGTTACTGCCGGTTTGAAAATATGCCTGCAATYTGAGCCAGT
GCTTTAATGGCATGTCAGACAGAACTTGAATGTGTCAGGTGACCCTGATGAAAACATAGC
ATCTCAGGAGATTTCATGCCTGGTGCTTCCAAATATTGTTGACAACTGTGACTGTACCCA
AATGGAAAGTAACTCATTTGTTAAAATTATCAATATCTAATATATATGAATAAAGTGTAA
GTTCACAACTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000619 unedited
GGGAGTTGGATTTTGTATACGATCATATAGGCGGCCGCGNAATTCGCTCGGNAAACGATG
AATATACAAGTTATATCTTGGCTTTTCAGCTCTGCATCGTTTTGGGTTCTCTTGGCTGTT
ACTGCCAGGACCCATATGTAAAAGAAGCAGAAAACCTTAAGAAATATTTTAATGCAGGTC
ATTCAGATGTAGCGGATAATGGAACTCTTTTCTTAGGCATTTTGAAGAATTGGAAAGAGG
AGAGTGACAGAAAAATAATGCAGAGCCAAATTGTCTCCTTTTACTTCAAACTTTTTAAAA
ACTTTAAAGATGACCAGAGCATCCAAAAGAGTGTGGAGACCATCAAGGAAGACATGAATG
TCAAGTTTTTCAATAGCAACAAAAAGAAACGAGATGACTTCGAAAAGCTGACTAATTATT
CGGTAACTGACTTGAATGTCCAACGCAAAGCAATACATGAACTCATCCAAGTGATGGCTG
AACTGTCGCCAGCAGCTAAAACAGGGAAGCGAAAAAGGAGTCAGATGCTGTTTCGAGGTC
GAAGAGCATCCCAGTAATGGTTGTCCTGCCTGCAATATTTGAATTTTAAATCTAAATCTA
TTTATTAATATTTAACATTATTTATATGGNGAATATATTTTTAGACTCATCAATCANATA
AGTATTTATAATAGCAACTTTTGTGNTATGAAAATGAATATCTATTAATATATGTATTAT
TTATAATTCCTATATCCTGTGACTGTCTCACTTAATCCTTTGTTTTCTGACTAAATTAGG
CAGGCTATGTGATTACAAGGCTTTATCTCAGGGGCCAACTANGCAGCCAACCTAAGCAAG
ATCCCATGGGTTNGTGTGTTTATTTCACTTTGATGATACATGAACACTTATNAGTGAAGG
Tag Tag Free
ACCN NM_000619
ORF Size 501 bp
Insert Size 1100
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000619.2, NP_000610
RefSeq Size 1240
Locus ID 3458
Cytogenetics 12q15
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Proteasome, Cytokine-cytokine receptor interaction, Regulation of autophagy, TGF-beta signaling pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, Type I diabetes mellitus, Systemic lupus erythematosus, Allograft rejection, Graft-versus-host disease
Gene Summary Produced by lymphocytes activated by specific antigens or mitogens. IFN-gamma, in addition to having antiviral activity, has important immunoregulatory functions. It is a potent activator of macrophages, it has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.