Nicotinic Acetylcholine Receptor alpha 7(CHRNA7) (NM_000746) Human Untagged Clone

CAT#: SC124074

CHRNA7 (untagged)-Human cholinergic receptor, nicotinic, alpha 7 (CHRNA7), transcript variant 1

USD 794.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Nicotinic Acetylcholine Receptor alpha 7(CHRNA7) (NM_000746) Human Untagged Clone
Symbol CHRNA7
Synonyms CHRNA7-2; NACHRA7
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_000746, the custom clone sequence may differ by one or more nucleotides


ATGCGCTGCTCGCCGGGAGGCGTCTGGCTGGCGCTGGCCGCGTCGCTCCTGCACGTGTCCCTGCAAGGCG
AGTTCCAGAGGAAGCTTTACAAGGAGCTGGTCAAGAACTACAATCCCTTGGAGAGGCCCGTGGCCAATGA
CTCGCAACCACTCACCGTCTACTTCTCCCTGAGCCTCCTGCAGATCATGGACGTGGATGAGAAGAACCAA
GTTTTAACCACCAACATTTGGCTGCAAATGTCTTGGACAGATCACTATTTACAGTGGAATGTGTCAGAAT
ATCCAGGGGTGAAGACTGTTCGTTTCCCAGATGGCCAGATTTGGAAACCAGACATTCTTCTCTATAACAG
TGCTGATGAGCGCTTTGACGCCACATTCCACACTAACGTGTTGGTGAATTCTTCTGGGCATTGCCAGTAC
CTGCCTCCAGGCATATTCAAGAGTTCCTGCTACATCGATGTACGCTGGTTTCCCTTTGATGTGCAGCACT
GCAAACTGAAGTTTGGGTCCTGGTCTTACGGAGGCTGGTCCTTGGATCTGCAGATGCAGGAGGCAGATAT
CAGTGGCTATATCCCCAATGGAGAATGGGACCTAGTGGGAATCCCCGGCAAGAGGAGTGAAAGGTTCTAT
GAGTGCTGCAAAGAGCCCTACCCCGATGTCACCTTCACAGTGACCATGCGCCGCAGGACGCTCTACTATG
GCCTCAACCTGCTGATCCCCTGTGTGCTCATCTCCGCCCTCGCCCTGCTGGTGTTCCTGCTTCCTGCAGA
TTCCGGGGAGAAGATTTCCCTGGGGATAACAGTCTTACTCTCTCTTACCGTCTTCATGCTGCTCGTGGCT
GAGATCATGCCCGCAACATCCGATTCGGTACCATTGATAGCCCAGTACTTCGCCAGCACCATGATCATCG
TGGGCCTCTCGGTGGTGGTGACAGTGATCGTGCTGCAGTACCACCACCACGACCCCGACGGGGGCAAGAT
GCCCAAGTGGACCAGAGTCATCCTTCTGAACTGGTGCGCGTGGTTCCTGCGAATGAAGAGGCCCGGGGAG
GACAAGGTGCGCCCGGCCTGCCAGCACAAGCAGCGGCGCTGCAGCCTGGCCAGTGTGGAGATGAGCGCCG
TGGCGCCGCCGCCCGCCAGCAACGGGAACCTGCTGTACATCGGCTTCCGCGGCCTGGACGGCGTGCACTG
TGTCCCGACCCCCGACTCTGGGGTAGTGTGTGGCCGCATGGCCTGCTCCCCCACGCACGATGAGCACCTC
CTGCACGGCGGGCAACCCCCCGAGGGGGACCCGGACTTGGCCAAGATCCTGGAGGAGGTCCGCTACATTG
CCAACCGCTTCCGCTGCCAGGACGAAAGCGAGGCGGTCTGCAGCGAGTGGAAGTTCGCCGCCTGTGTGGT
GGACCGCCTGTGCCTCATGGCCTTCTCGGTCTTCACCATCATCTGCACCATCGGCATCCTGATGTCGGCT
CCCAACTTCGTGGAGGCCGTGTCCAAAGACTTTGCGTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_000746 unedited
TAAAGTCAGATTTTGTAAACGACTCACTATAGGCGGCCGCGAATTCGCACGAGGCGGCGA
GGTGCCTCTGTGGCCGCAGGCGCAGGCCCGGGCGACAGCCGAGACGTGGAGCGCGCCGGC
TCGCTGCAGCTCCGGGACTCAACATGCGCTGCTCGCCGGGAGGCGTCTGGCTGGCGCTGG
CCGCGTCGCTCCTGCACGTGTCCCTGCAAGGCGAGTTCCAGAGGAAGCTTTACAAGGAGC
TGGTCAAGAACTACAATCCCTTGGAGAGGCCCGTGGCCAATGACTCGCAACCACTCACCG
TCTACTTCTCCCTGAGCCTCCTGCAGATCATGGACGTGGATGAAAAGAACCAAGTTTTAA
CCACCAACATTTGGCTGCAAATGTCTTGGACAGATCACTATTTACAGTGGAATGTGTCAT
AATATCCAGGGGTGAAGACTGTTCGTTTCCCAGATGGCCACATTTGGAAACCAGACATTC
TTCTCTATAACAGTGCTGATGAGCGCTTTGACGCCACATTCCACACTAACGTGTTGGTGA
ATTCTTCTGGGCATTGCCAGTACCTGCCTCCAGGCATATTCAAGAGTTCCTGCTACATCG
ATGTACGCTGGTTTCCCTTTGATGTGCAGCACTGCATACTGAAGTTTGGGTCCTGGTCTT
ACGGACGCTGGCCCTTGGATCTGCAGATGCAGGGAGCAGATATCACTGGCTATATCCGCA
AGGGAAAATGGGACCTAGTGGGAATCCCCCGCAAGAGGAGTGAAAGGTTATATGAGTGCT
GCAAAGAACCCTACCCCGATGTCAACTTTACAGTGACCATGCGCAAAAGGACGCTCCACT
ATTGGGCTCAACGGCTGATCCCCTGGGGGAAAAATTTCCACCCTGCGCTG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000746 unedited
CATGGCAACTTCCAGGCCAGGAGAGGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGA
TCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTT
GTTTTTTTTAACGGAGAAACAGCATCAAGCTGTTTCTCTCTACCGTCTTTGATAGAAATA
AAAATAAAAATAAAAAGTTGAATTGCAGAAAAGCTAAGAGGTTTTTAGTTTTTGTTTTTT
GTTTTCCTTCCACCAGTCAATTATTGGAAAGGATTTAGTGAGTCTGGTTTATTTTAGCTT
CAATCTGGGTTTGTACACAAGCAAAAAGCAAATGTTGAATTTTCAAGTAGACCTTCATGC
AGACATGCAAAACCAACTGTCTCGGTGGTGAGGAGCCATGGGGAGCTCTCCGAAGGGCTT
TCCAAGCAGTGGGCTAATGGGCAAAATGACTACTCAATGGCCCTGCTTACCGATGGTACT
GATGTGCCAAGGAATATCTATCAGCCCATCCGAAAATATTGAAACAAATGCTTGAGTTTC
TCTTCCCTAAAGTAGCAAAGATACCGTAGGCACCACGACTTGACAGCCAGATGGGACCAC
TTGAGTTGAGGCGTGTAATGCTGTCCTGTATTAGCACCCCCAAATCTCGTCAAGCCCAAA
GGCCTTGCCCATCTGTGATCTTCCACATGTACAGAACCCAGCGTAGTTACGCCAAGTCTT
TTGACACGGCCTTCACGAAGTGGCAGCCGACTACNTGTTGCCAATGGTGCCAATTAGGGT
AAGAACCGGAAGGCTTAAGGGAAGGCGTTCTCCCACGGCGGAGAT
Tag Tag Free
ACCN NM_000746
ORF Size 1509 bp
Insert Size 4900
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000746.2, NP_000737
RefSeq Size 2155
RefSeq ORF 1509
Locus ID 1139
Cytogenetics 15q13.3
Protein Families Ion Channels: Cys-loop Receptors, Transmembrane, Druggable Genome
Protein Pathways Calcium signaling pathway
Gene Summary The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
Transcript Variant: This variant (1) lacks an in-frame portion of the 5' coding region, compared to variant 2. The resulting isoform (1) has a shorter N-terminus, compared to isoform 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)