IL20 Receptor alpha (IL20RA) (NM_014432) Human Untagged Clone

CAT#: SC123985

Reviews ()
Write a review

IL20RA (untagged)-Human interleukin 20 receptor, alpha (IL20RA)

  View "NM_014432" in other vectors (10)

USD 760.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name IL20 Receptor alpha (IL20RA) (NM_014432) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol IL20RA
Synonyms CRF2-8; IL-20R-alpha; IL-20R1; IL-20RA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_014432, the custom clone sequence may differ by one or more nucleotides


ATGCGGGCTCCCGGCCGCCCGGCCCTGCGGCCGCTGCCGCTGCCGCCGCTGCTGCTGTTGCTCCTGGCGG
CGCCTTGGGGACGGGCAGTTCCCTGTGTCTCTGGTGGTTTGCCTAAACCTGCAAACATCACCTTCTTATC
CATCAACATGAAGAATGTCCTACAATGGACTCCACCAGAGGGTCTTCAAGGAGTTAAAGTTACTTACACT
GTGCAGTATTTCATATATGGGCAAAAGAAATGGCTGAATAAATCAGAATGCAGAAATATCAATAGAACCT
ACTGTGATCTTTCTGCTGAAACTTCTGACTACGAACACCAGTATTATGCCAAAGTTAAGGCCATTTGGGG
AACAAAGTGTTCCAAATGGGCTGAAAGTGGACGGTTCTATCCTTTTTTAGAAACACAAATTGGCCCACCA
GAGGTGGCACTGACTACAGATGAGAAGTCCATTTCTGTTGTCCTGACAGCTCCAGAGAAGTGGAAGAGAA
ATCCAGAAGACCTTCCTGTTTCCATGCAACAAATATACTCCAATCTGAAGTATAACGTGTCTGTGTTGAA
TACTAAATCAAACAGAACGTGGTCCCAGTGTGTGACCAACCACACGCTGGTGCTCACCTGGCTGGAGCCG
AACACTCTTTACTGCGTACACGTGGAGTCCTTCGTCCCAGGGCCCCCTCGCCGTGCTCAGCCTTCTGAGA
AGCAGTGTGCCAGGACTTTGAAAGATCAATCATCAGAGTTCAAGGCTAAAATCATCTTCTGGTATGTTTT
GCCCATATCTATTACCGTGTTTCTTTTTTCTGTGATGGGCTATTCCATCTACCGATATATCCACGTTGGC
AAAGAGAAACACCCAGCAAATTTGATTTTGATTTATGGAAATGAATTTGACAAAAGATTCTTTGTGCCTG
CTGAAAAAATCGTGATTAACTTTATCACCCTCAATATCTCGGATGATTCTAAAATTTCTCATCAGGATAT
GAGTTTACTGGGAAAAAGCAGTGATGTATCCAGCCTTAATGATCCTCAGCCCAGCGGGAACCTGAGGCCC
CCTCAGGAGGAAGAGGAGGTGAAACATTTAGGGTATGCTTCGCATTTGATGGAAATTTTTTGTGACTCTG
AAGAAAACACGGAAGGTACTTCTCTCACCCAGCAAGAGTCCCTCAGCAGAACAATACCCCCGGATAAAAC
AGTCATTGAATATGAATATGATGTCAGAACCACTGACATTTGTGCGGGGCCTGAAGAGCAGGAGCTCAGT
TTGCAGGAGGAGGTGTCCACACAAGGAACATTATTGGAGTCGCAGGCAGCGTTGGCAGTCTTGGGCCCGC
AAACGTTACAGTACTCATACACCCCTCAGCTCCAAGACTTAGACCCCCTGGCGCAGGAGCACACAGACTC
GGAGGAGGGGCCGGAGGAAGAGCCATCGACGACCCTGGTCGACTGGGATCCCCAAACTGGCAGGCTGTGT
ATTCCTTCGCTGTCCAGCTTCGACCAGGATTCAGAGGGCTGCGAGCCTTCTGAGGGGGATGGGCTCGGAG
AGGAGGGTCTTCTATCTAGACTCTATGAGGAGCCGGCTCCAGACAGGCCACCAGGAGAAAATGAAACCTA
TCTCATGCAATTCATGGAGGAATGGGGGTTATATGTGCAGATGGAAAACTGA


>OriGene 5' read for NM_014432 unedited
CCGTGTCAGATTTTGTATCCGACTCATATAGGCGGCCGCGCAATTCGCACGAGGCCGATA
TTGAACTTTAACTGACCATCAGACCGGCCTGAATACCAGAATCTCTTTGCAATGCACTCG
CCTCGCTCATTACCAGAAGGAGGTTTTACCTGCCTAGTGACCTGGTTGGTCTGGGCATGA
ACCCCGAGAGGTGGAAACTCTCAGACTCTCAGGACTGACAGCCGAGTGGCTGGGGACTAT
AAATCCGCGAGAACTGCCCTCGCGCTGCCATCCAGCTGGGTAGCCGGGGGAGCGCGCGTG
GGGGCTCCGCGAGTCGCTCGCCCTTGGTTTCTGGGGAAGCCTGGGGGACGCGGCTGTGGC
GGAGGCGCCCTGGGACTCAGGTCGCCTGGAGCGTGGCACGCAAAGCCCCAGGCGCGGAGC
TGAGGCCGCGCGGCCGCGCTTGGCCCCAGCGGGCGTGGGACTGAGCAGTCTGCTGCCCCC
CGACATGTGACCCAGCCCCGCCGCCCATGCGGGCTCCCGGCCGCCCGGCCCTGCGGCCGC
TGCCGCTGCCGCCGCTGCTGCTTGTTGCTCCTGGCGGCGCCTTTGGGAACGGCAGTTCCC
TGTGTCTCTGGTGGTTTTGCCTAAACCTGGAGACATCACCTTCTAATCCATGTACATGAA
GGATGTCCTACAAGGACTTCCCCACGAGCGTCCTCAAGGAGTTAAAAGTTACTTCCAGTG
GGCAAGTATTTCATACCACATTGGGCCACCATAAGGTGCACTGACTACAGAGTAGAAGTC
CATTTGTGTTGTCTTGACTGTCCCCGAGAAAGGGAAGAAGAAGTCATAAGAAACTTGCTT
GTTCGTTGTAACAAATTTCTCTCATCCGTAGTTCACACTGTGCTGGTGCGAAACAAAAAT
AAACAAAAGCTGGACG
>OriGene 3' read for NM_014432 unedited
GGAGTGCACTTCCAGGGCCAGGAGAGGCACTGGGGAGGGGTCACAGGGATGCCACCCGGG
ATCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTT
TTTTTATCATCAATCACTTTATTTTTCTTTTGCTCTTAATAACAATTTATTCTTTCTCAC
TCTTGAACTACTTTTACAGTTAGTGTAATACATCTGTTCTTCAAAACCAGCAGAATCGTT
TCTATAAAGATTGAGAATAACAGAACACTCTGATTAATATAATTACTCCCTAAATTAAAC
CATTAGATCTGAAACTGTTTGCATTTGCGGATAATCACGAAAGGTCATGACCCCAGAATC
CATCTCTCCTACCAGGGTTGTCTGCCTGTACCAATAATATCAATAAGGAAATATGGGTGA
TATCTCTTCTCATGAAAGAGCATCAATGGATTATGAGTTCATGACTAAAACAAATATATA
TTAAGGCAAACCATATGAAGTTACTGCTTGTCAGATTAAAAACAGCCAAATATCCACAAT
TATATATGGTTCAACTTAATAGATTTTGTCCCATTTTAAAGCAGCGTGACTGAAGAATTT
AATTTTCTTAACAAGTGGTAAAGGAGATGGGAACAGTTACTGGAAATGAACTAGAAAGCT
ATTGTTTTATGGCATAGTTTAGTTCCTACAGTANATTTCATCAAATTTTAATAAACTCTC
CCTTACATAGTCATTTTACTCATTTCTCTTGATGTCCAATATTACTTATGGTTTTAATAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_014432
ORF Size 1662 bp
Insert Size 4000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_014432.2, NP_055247.2
RefSeq Size 3682
RefSeq ORF 1662
Locus ID 53832
Cytogenetics 6q23.3
Domains Tissue_fac
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway
Gene Summary This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

Other products for "IL20RA"
Frequently bought together (2)
IL20RA mouse monoclonal antibody,clone OTI1B12
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones