GGT5 (NM_004121) Human Untagged Clone

CAT#: SC117572

GGT5 (untagged)-Human gamma-glutamyltransferase 5 (GGT5), transcript variant 2

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name GGT5 (NM_004121) Human Untagged Clone
Symbol GGT5
Synonyms GGL; GGT 5; GGT-REL; GGTLA1
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC117572 sequence for NM_004121 edited (data generated by NextGen Sequencing)
ATGGCCCGGGGCTACGGGGCCACGGTCAGCCTAGTCCTGCTGGGTCTGGGGCTGGCGCTG
GCTGTCATTGTGCTGGCTGTGGTCCTCTCTCGACACCAGGCCCCATGTGGCCCCCAGGCC
TTTGCCCACGCTGCTGTTGCCGCCGACTCCAAGGTCTGCTCGGATATTGGACGAGCCATC
CTCCAGCAGCAGGGCTCACCCGTGGATGCCACCATCGCGGCTCTGGTCTGCACCAGCGTC
GTCAACCCTCAGAGCATGGGCCTGGGCGGAGGGGTCATCTTCACCATCTACAATGTGACA
ACAGGGAAGGTGGAGGTCATCAATGCCCGGGAGACGGTGCCGGCCAGCCACGCCCCGAGC
CTGCTGGACCAGTGTGCACAGGCTCTGCCACTGGGCACAGGGGCCCAGTGGATCGGGGTG
CCCGGGGAGCTCCGTGGCTATGCCGAGGCCCACCGCCGCCATGGCCGCCTGCCCTGGGCG
CAGCTGTTCCAGCCCACCATCGCGCTGCTCCGAGGGGGGCATGTGGTGGCCCCTGTCCTC
AGCCGTTTCCTGCACAACAGCATCCTGCGGCCTTCCTTGCAGGCGTCAACCCTGCGCCAG
CTCTTCTTCAACGGGACAGAACCCCTGAGGCCTCAGGACCCACTCCCATGGCCTGCACTG
GCCACCACCCTGGAGACCGTGGCCACAGAGGGCGTGGAGGTCTTCTACACGGGGAGGCTG
GGCCAGATGCTGGTGGAGGACATTGCCAAGGAAGGGAGCCAGCTGACGCTGCAGGACCTG
GCCAAGTTCCAGCCCGAGGTGGTGGATGCCCTGGAGGTGCCCCTGGGGGACTATACCCTG
TACTCACCACCGCCGCCTGCAGGGGGTGCCATTCTCAGCTTTATCCTCAACGTGCTAAGA
GGGTTCAACTTCTCAACAGAGTCTATGGCCAGGCCTGAAGGGAGGGTGAACGTGTACCAC
CACCTTGTAGAGACGCTCAAGTTTGCCAAGGGGCAGAGGTGGAGGCTGGGGGACCCTCGA
AGCCACCCGAAGCTCCAGAATGCCTCCCGGGACCTGCTGGGGGAGACCCTGGCCCAGCTC
ATCCGCCAACAGATCGATGGCCGGGGGGACCACCAGCTCAGCCACTACAGCTTGGCCGAG
GCCTGGGGCCACGGGACAGGCACGTCCCATGTGTCTGTGCTGGGGGAGGATGGCAGCGCC
GTGGCTGCCACCAGCACCATCAACACACCCTTTGGAGCGATGGTGTATTCACCACGGACA
GGCATCATCCTCAACAACGAGCTCCTGGACTTATGCGAGCGATGCCCCCGGGGTTCCGGC
ACCACCCCCTCACCTGTGAGTGGAGACAGGGTGGGTGGAGCTCCCGGAAGGTGCTGGCCC
CCAGTTCCAGGCGAGCGTTCCCCATCCTCCATGGTGCCCTCCATCTTGATCAACAAAGCC
CAGGGGTCGAAGCTAGTGATTGGCGGGGCTGGCGGGGAGCTCATCATCTCTGCTGTGGCC
CAGGCCATCATGAGCAAGCTGTGGCTTGGCTTTGACCTGAGAGCGGCCATTGCAGCCCCC
ATCCTGCATGTCAACAGCAAGGGCTGTGTGGAGTACGAGCCCAACTTCAGCCAGGAGGTG
CAGAGGGGACTCCAAGACCGTGGCCAGAACCAGACCCAGAGGCCCTTCTTCCTGAACGTG
GTCCAGGCTGTGTCCCAGGAGGGGGCCTGTGTGTACGCCGTCTCGGACCTGAGGAAGAGT
GGGGAGGCCGCAGGCTACTAA

Clone variation with respect to NM_004121.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004121 unedited
GTTCTTTCCCCGCCCGTTGCCGCATTGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATA
AGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCC
GCGAATTCGGCACGAGGGGGAACCCGGGGAATGGTGTGGAGGTTCCAGGGAGCCCTGCCC
CTACCTGGCAACCGCAGTGCAGCAGGCACCAAGTTCTCCTGCACATTGCGACAGTGTGAC
CCTGGGCTCTGGCGGGCGGTAGGTGGGGCCTTTGGACCTACTAGCAGTGAGGGAGTTAAC
ACAGCAGCTGACTCCTCTAGGCAAGGAAAACTCCCCTCAGACGCTTTGCTGCCTGGCCTC
CTGCCAGCAACAAGCAGGAGCTGAAAACCAGAAGTTGAGGCGTGAGTTTGGCCACTCCGT
AGTGTGCACTTGGTGAGGGCAGCAGCTCGCCACAGCTGCCAGCCATCTGTCCATTCACCC
ATCTGTCCATCTGGCAGCCCGCTGTTCAGACCTGTCTGTCTGTCCGCCCATCTGTAAGCC
CATCTCTGTCCCATTGTCTATCTGACCATCTTTCTCTTACTGTCCTCTTTGTCTAGCTAT
CTGGCCTATCTGTCGATCCATCTTCGTGTCTGTCTTCAGCCCCCACCTGTTTGTCCATCT
GTCCAATTACCTGTGACTCTGTGCATCTTCTTGTCCATTCATCTGCCCACCCATCCGTCC
CTCCGTCTGCCACCAGCCGNCCCTCTCCTCCTGGGCTGCAGAGCCATGGCCCGGGGCTAC
GGNGCCACGGTCAGCCTATCCTGCNTGGTCTGNNNGCTGCGCCTGCTGTCATTGTGCTGC
CTGTGGTCCTCTCTCGACACAGCCCCCATGTGGCCCCCAGNCCTTGCCACGCTGCTGTGC
CGCCGATCCAAGTCTGCTCGATTTTGGACGAGCCTCCTCCAC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004121 unedited
NTGGGTTTACTATGNACGCGGCCGCATTCTANGATCGAGTTTTTTTTTTTTTTTTTTGTT
TTTTTTTTTTTTTTTTTTTCACAGTCCGCCTCTTTAATCTTGGACTGGAGGATATACAGA
TCGAGAGGGTGGGAGAGTGGCCCCAGGCAAGAGGCCTGCGGAGGGATAGAGGGGCCGGTT
CAGGACCACCAGGGGCTCTGGGAAAGGGGGTTAGGGATGAGGCTCAACCTCTCATCTGCC
CAGCTGGGCCCCGCCACCTTTTCCACTCTCAGCTGGACTCCCCTGCCAGGGGTCCAGATC
CTGCCAGAGTAGTTGGTCCCCCAGCCATGTCCGGCCTGGACACAGGACTCATGGGGGGGC
CAGACTTTAGCTCTGGGCAAAGCAGTGTCTTAATAGCCTGGGGCCTCCCCACTCTTCCTC
AGGTCCGAGACGGGGTACACACAGGCCCCCTCCTGGGACACAGCCTGGACCACGTTCAGG
AAGAAAGGCCTCTGGGTCTGGTTCTGGCCACGGTCTTGGAGTCCCCTCTGCACCTCCTGT
AATGCCAGCAATTTGGGAGGCTGAGGAAGGAGGATCACTTGAGGCCAGGAGTTTGAGACC
AACCTGGGCAATGCAGCAAGATCCTGTTTCTGGCTGAAGTTGGGCTCGTACTCCACAAAA
CCCTTGCTGTTTACTGCAAGATGGGGGCTGGAATGGGCGCTCTTAGGGCAAAGACAAACC
CCAGTTTGCTTATGATGGCCCTGGGCCCACCAAAAAAAATAAGCTCCCCCCCGCCCCGCC
AATCAATATCTTTTACCCCGGGGTTTTTTTTAACAATGGAGGGCACCCTGGAGGATGGGG
AAACCTTCCCTGGAAATGGGGGGCCCCCCTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_004121
ORF Size 1761 bp
Insert Size 3000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004121.1, NP_004112
RefSeq Size 2414
RefSeq ORF 1761
Locus ID 2687
Cytogenetics 22q11.23
Domains G_glu_transpept
Protein Families Transmembrane, Protease
Protein Pathways Taurine and hypotaurine metabolism, Selenoamino acid metabolism, Cyanoamino acid metabolism, Glutathione metabolism, Arachidonic acid metabolism, Metabolic pathways
Gene Summary This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014].
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. The encoded isoform (2) is one amino acid shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.