Cytochrome b c1 complex subunit 9(UQCR10) (NM_013387) Human Untagged Clone

CAT#: SC115241

UQCR10 (untagged)-Human ubiquinol-cytochrome c reductase, complex III subunit X (UQCR10), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cytochrome b c1 complex subunit 9(UQCR10) (NM_013387) Human Untagged Clone
Symbol UQCR10
Synonyms HSPC051; HSPC119; HSPC151; QCR9; UCCR7.2; UCRC
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC115241 sequence for NM_013387 edited (data generated by NextGen Sequencing)
ATGGCGGCCGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTTCCGCAGGACCTCCACC
TTCGCCCTCACCATCATCGTGGGCGTCATGTTCTTCGAGCGCGCCTTCGATCAAGGCGCG
GACGCTATCTACGACCACATCAACGAGGGGAAGCTGTGGAAACACATCAAGCACAAGTAT
GAGAACAAGTAG

Clone variation with respect to NM_013387.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_013387 unedited
CGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGGACTGTGAAGAAACATGGCGGC
CGCGACGTTGACTTCGAAATTGTACTCCCTGCTGTTCCGCAGGACCTCCACCTTCGCCCT
CACCATCATCGTGGGCGTCATGTTCTTCGAGCGCGCCTTCGATCAAGGCGCGGACGCTAT
CTACGACCACATCAACGAGGGGAAGCTGTGGAAACACATCAAGCACAAGTATGAGAACAA
GTAGTTCCTTGGAGGCCCCCATCCAGGCCAGAAGGACCAGGTCCACCCAGCAGCTGTTTG
CCCAGAGCTGGAGCCTCAGCTTGAAGATGATGCTCAAGGTACTCTTCATGGACCACCATT
CGCTGTTGGCAAGAAACGGCTTTACTTACAAAACAGACTCTTTACCTTCTGCTGTGTTTG
AAGTATGTTTAGTCAGCATGCTCAGGAAATAAATGTGAATTGCCCTTGAAAAAAAAAAAA
AAAAAACTCGACTCTAGATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGT
GGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGC
CCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCT
ATATATTATGGGGTGGGGGGGGGTGGGNATTGGAGACAAAGGGGCAAATNGGGAAAGAAC
AACCTGTANGGGCCCTGCGGTGTCTATTGGNGAACCAAAGCTGGAGTGCAGTGGCACAAA
TCTGGGCTCACTGNCATCTCCGNCTNCTGGGTCAAAGCGATNCTCTGCCTCAGCTNCCGA
GTGNNNTGGATTCAGCATGCATGACCAGCTCACTAATTTTTGTTTTTGTTAGAAAGGGGT
TTCACATANTTGGCAGCGTGTCTNCACTNCTATCTTCAGGGATCTACCCACCTGGCCTNC
CAANNTGCTGGATNACAGNCGTGAACCACTGTTT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_013387 unedited
GCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTCAAGGGCAATTCACATTTATTTCCTG
AGCATGCTGACTAAACATACTTCAAACACAGCAGAAGGTAAAGAGTCTGTTTTGTAAGTA
AAGCCGTTTCTTGCCAACAGCGAATGGTGGTCCATGAAGAGTACCTTGAGCATCATCTTC
AAGCTGAGGCTCCAGCTCTGGGCAAACAGCTGCTGGGTGGACCTGGTCCTTCTGGCCTGG
ATGGGGGCCTCCAAGGAACTACTTGTTCTCATACTTGTGCTTGATGTGTTTCCACAGCTT
CCCCTCGTTGATGTGGTCGTAAATAGCGTCCGCGCCTTGATCGAAGGCGCGCTCGAAGAA
CATGACGCCCACGATGATGGTGAGGGCGAAGGTGGAGGTCCTGCGGAACAGCAGGGAGTA
CAATTTCGAAGTCAACGTCGCGGCCGCCATGTTTCTTCACAGTCCCCTCGTGCCGAATTC
GCGGCCGCCCTATAGTGAGTCGTATTACAAAATTCTGACGGTTCACTAAACGAGCTCTGC
TTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAACGGGGCGGGGTTAT
TACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACATACTCCCATTGACGTCAA
TGGGGTGGAGACTTGGAAANTCCCGTGAGTCATACCGCTATCCACGCCCATTGTTGTACT
GCCAAAACCGCATCACCATGGTAATAGCGATGACTAATACGTANATGTACTGCCAAGTAN
GAATATCCCGTAAAGTCATGTACTGGGCATAATGCCAGGCCGCCCATTTACCGTCATTGA
CGTCAATGGGGGCGGACCTGGCATATGATCACTTGATGTACTGCCAGGGGGCAGTTACCG
TAATACTCCACCTTGACCTCATGAAAGTCCCTATGGCGTACTATGGAACTACCTCTTTTG
ACGCAATGGCGGGGGCCTTGGCGGTCATCCAGCGGCCTTTACGTAGTTATGACCGGATCC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_013387
ORF Size 192 bp
Insert Size 480
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_013387.3, NP_037519
RefSeq Size 934
Locus ID 29796
Cytogenetics 22q12.2
Protein Families Transmembrane
Protein Pathways Oxidative phosphorylation, Metabolic pathways, Cardiac muscle contraction, Alzheimer's disease, Parkinson's disease, Huntington's disease
Gene Summary UCRC is a subunit of mitochondrial complex III (ubiquinol-cytochrome c reductase; EC 1.10.2.2), which forms the middle segment of the respiratory chain of the inner mitochondrial membrane (Schagger et al., 1995 [PubMed 8592474]).[supplied by OMIM, Mar 2008].
Transcript Variant: This variant (1) encodes the longer and predominant isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.