CDC23 (BC010944) Human Untagged Clone

CAT#: SC105953

CDC23 (untagged)-Homo sapiens, clone MGC:13585 IMAGE:4281800, complete cds

USD 1,113


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CDC23 (BC010944) Human Untagged Clone
Symbol CDC23
Synonyms APC8; anaphase-promoting complex subunit 8; cell division cycle protein 23; cell division cycle 23 homolog (S. cerevisiae)
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for BC010944, the custom clone sequence may differ by one or more nucleotides


ATGGTCCCGGTGGCTGTGACGGCGGCAGTGGCGCCTGTCCTGTCCATAAACAGCGATTTCTCAGATTTGC
GGGAAATTAAAAAGCAACTGCTGCTTATTGCGGGCCTTACCCGGGAGCGGGGCCTACTACACAGTAGCAA
ATGGTCGGCGGAGTTGGCTTTCTCTCTCCCTGCATTGCCTCTGGCCGAGCTGCAACCGCCTCCGCCTATT
ACAGAGGAAGATGCCCAGGATATGGATGCCTATACCCTGGCCAAGGCCTACTTTGACGTTAAAGAGTATG
ATCGGGCAGCACATTTCCTGCATGGCTGCAATAGCAAGAAAGCCTATTTTCTGTATATGTATTCCAGATA
TCTGGTGAGGGCCATTTTAAAATGTCATTCTGCCTTTAGTGAAACATCCATATTTAGAACCAATGGAAAA
GTTAAATCTTTTAAATAG


5' Read Nucleotide Sequence
>OriGene 5' read for BC010944 unedited
NGGGTCACATTGATACACTATTAGGGGCCGGATTCGCCGAGGGAAAATGGCTGCGAGTAC
CTCCATGGTCCCGGTGGCTGTGACGGCGGCAGTGGCGCCTGTCCTGTCCATAAACAGCGA
TTTCTCAGATTTGCGGGAAATTAAAAAGCAACTGCTGCTTATTGCGGGCCTTACCCGGGA
GCGGGGCCTACTACACAGTAGCAAATGGTCGGCGGAGTTGGCTTTCTCTCTCCCTGCATT
GCCTCTGGCCGAGCTGCAACCGCCTCCGCCTATTACAGAGGAAGATGCCCAGGATATGGA
TGCCTATACCCTGGCCAAGGCCTACTTTGACGTTAAAGAGTATGATCGGGCAGCACATTT
CCTGCATGGCTGCAATAGCAAGAAAGCCTATTTTCTGTATATGTATTCCAGATATCTGTC
TGGAGAAAAAAAGAAGGACGATGAAACAGTTGATAGCTTAGGCCCCCTGGAAAAAGGACA
AGTGAAAAATGAGGCGCTTAGAGAATTGAGAGTGGAGCTCAGCAAAAAACACCAAGCTCG
AGAACTTGATGGATTTGGACTTTATCTGTATGGTGTGGTGCTTCGAAAACTGGACTTGGT
TAAAGAGGCCATTGATGTGTTTGTGGAAGCTACTCATGTTTTGCCCTTGCATTGNGGAGC
CTGGTTAGAACTCTGTAACCTGATCACAGACAAAGAGATGCTGAAGTTCCTGTCTTTGCC
AGACACCTGGATGAAAGAAGTTTTTCTGGCTCATATATACACAGAGTTGCAGTTGATAGA
GGAGGCCCTGCAAAGTATCAGAACTCATTGATGTGGGCTTTCTCTAGAGCTCGTATATTG
TTTCCCAAATTGCAGTTGCCTATCACATATCAGAGATATTGACCAAGCCCTCTCCATTTT
TATGAN
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN BC010944
ORF Size 438 bp
Insert Size 3500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC010944.1, AAH10944
RefSeq Size 1088
RefSeq ORF 438
Locus ID 8697
Cytogenetics 5q31.2
Domains APC8
Protein Families Druggable Genome
Protein Pathways Cell cycle, Oocyte meiosis, Ubiquitin mediated proteolysis, Progesterone-mediated oocyte maturation
Gene Summary The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae Cdc23, a protein essential for cell cycle progression through the G2/M transition. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eukaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.