Calcium binding protein P22(CHP1) (AK093949) Human Untagged Clone

CAT#: SC104234

(untagged)-Human cDNA FLJ36630 fis, clone TRACH2018278

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Calcium binding protein P22(CHP1) (AK093949) Human Untagged Clone
Symbol CHP1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for AK093949, the custom clone sequence may differ by one or more nucleotides


GTTGGTTATTTGCCTTTACTTTTATTTATTTGTTTTGATATGTAGATACATTTACATTTTTTATGTAATA
TATCTTTTTAAAAATGGTTTCTGCTTTTCCTGAACATGTTTTCAGAATTTAAAATTGTATATGGAAAACA
AATTACATGAAAGATTTGAGCATTTCAAAATTTTAAACATAAAAGCATAAACGTAGATAAAATGAAGGTG
TACTATGATATCTTCAGTTTTATCAGAAATGATGTAAAAATTACAACCTCTTTAAAAAGTAGTGTTAATC
ATTAAGTTAGAAAATATATAGCTGGGCATGGTGGCAGATGCCTGTAATCCCAGCTACATGGGAAGGTGAG
GTGGGAGAATCGCTTGAACCCAGGCAGTGGAGGATGCAGTGAGCCAAGATCATGCCACTGCACCCCAGCC
TGGGTGACAGAACAAGACTCCATCTCAAGAAAAAAAAAAAAAAAGAAAAATATATATATGAACTTCAGAA
TCTGAGGTCATATATAGACAGGTCTTTCCCCCGTTTCCTCTACTTTTTCTTGTAGCTTGGAATTAGTCAG
TTTCATCATGCTATAATAAGCTTATCTGAAAGGCAGTAAAGTGATATTTTGTACAACTTCATTGGCTTTT
TGAGAAGAACATTTTTAGGTTCTTAGTCCTAGAATTCTGCTGTTTGCTTGGAAAAAGAAAGTAATACATT
TTCTTCTATGAAGGATTTCCTCAGCACACCATTGCTTCTTTATCTGACCAGGATGCAAAACCCTCTTTCA
GCATGGCGTAAGTAAAGACCTTGAAAATATCAGTAATAATGTTTTTACATTTTTAATTCCTTCTTTTAAG
TTATAAATTCAAAAGATAGGCAATGAAGACTATCTCTATATACTTGTATGGAGTGATCTTCAGGATAAAT
TACTAAGTAAAACAGTAGTTTGAGAGAATTTTGTAGTATGCTGCTAATCACCTAAGAAGAAAGTAGAGAT
GTAAGTGGATGTATATACTTGTTTATGTTAATAATAAAAACAATAGTATGGAAATAATAAAAACTTAAAA
GGGGTGGAGGGGGAAATTTTTTTTTTTTAATGTTTACCTCAGTGAGTGTGTAGGGAAAAGCAAAGGGTTA
GACCCTAGACTTTTCTGAATGCATCACTTAATGATAGGGACACATTCTGAGAAATGCGTCATTAGGTGAT
ACCATCATTGTGCAAACATCACAGAGTGCACTTACACAAACCTAGATAGTGTAGCCTACTAACATCGCAG
TTATATAGTATAGCCTATTGCTCCTAGGCCGCACACCTGTACAGCATATTGTGTACTGAATAATGTAGGC
AGTTGTAATGTAACACCTAGTGTTTGTTTAACTAAACACAGAAAAGGTACAACTAAAATGTATTATTTTA
TGGGACCACTGTCATATATGTGGTTCATCACTGACCAAAATGTTATATAGAATATTACTGTACCTTGTTT
TAACTTCAGAGCTTTGTATTTTACATAATTATAAAACAAAATTAAATTTAAGAGAGTAATTCTTAAAAAT
CACAAACAAGATTTCTGCCTCCAGCCAAAAAGCTGTAACAGGGACTAGATTTACCCTCCTGTCAAAAAAA
GCAGACAAAATATATAAAACAGTGGTTTTCAGACGTTGGACAGCAAGCCTTGCTGATAATGATCCCTGAA
AGAAAGGAAACAAATGAGATGGGCCCTAAGAGCACTCCACCTTACTGCCTGGATGGAATTTCCAGGCTGC
ACACAGAGGCTGGAGATGTTGTTGAGTTGAAGAAACAAAGTTCATCTTTCAAGGAGGCTGAGATGGCGAT
AATTTTGCAGGTCAGAGTACTGGAGAGGAAAGATCTGCACAGAGAGAACTCTCTGGGGAGCTGCATAGAC
TTGCTCATGAGTCAGCAGCTGAGCGTTGATCAGCCCTTTTGTGTGAGGAGACTACTGGAAGTCAGGGAAA
AAATCACTGGAAAGCAGCAGACAGAACAGTTTCCAGAGCTCACACAGAGAACATTCATGTTCTCACCAGT
CTGTATGGAAATACCTCTTAACATGACAGGCATTGAATAGAGTCCACAGTAATGGGATCAAATTAATTCT
ATCACAAGAACTGGAACCAGAGGCAAAAAGAAAAGAAAAGAAAAGAAAAATCTAGACTAACAGCTGTTCT
AGACCAGCCTACCAAAGTTTAAAAGCAAATTTTGAAGAGATTAAACTATTTCCAAGTTAATGAAGTATAT
TTCAGAACAAACCCTTAAATATTTGAGGGAATAC


5' Read Nucleotide Sequence
>OriGene 5' read for AK093949 unedited
GCGGCAACAATTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACCAGGTGAGGTGG
GAGAATCGCTTGAACCCAGGCAGTGGAGGATGCAGTGAGCCAAGATCATGCCACTGCACC
CCAGCCTGGGTGACAGAACAAGACTCCATCTCAAGAAAAAAAAAAAAGAAAAATATATAT
ATGAACTTCAGAATCTGAGGTCATATATAGACAGGTCTTTCCCCCGTTTCCTCTACTTTT
TCTTGTAGCTTGGAATTAGTCAGTTTCATCATGCTATAATAAGCTTATCTGAAAGGCAGT
AAAGTGATATTTTGTACAACTTCATTGGCTTTTTGAGAAGAACATTTTTAGGTTCTTAGT
CCTAGAATTCTGCTGTTTGCTTGGAAAAAGAAAGTAATACATTTTCTTCTATGAAGGATT
TCCTCAGCACACCATTGCTTCTTTATCTGACCAGGATGCAAAACCCTCTTTCAGCATGGC
GTAAGTAAAGACCTTGAAAATATCAGTGATAATGTTTTTACATTTTTAATTCCTTCTTTT
AAGTTATAAATTCAAAAGATAGGCAATGAAGACTATCTCTATATACTTGTATGGAGTGAT
CTTCAGGATAAATTACTAAGTAAAACAGTAGTTTGAGAGAATNTTGTAGTATGCTGCTAA
TCACCTAAGAAGAAAGTAGAGATGTAAGTGGATGTATATACTTGTTTATNGTAATAAATA
AAAACATAGTATGGAAATNAATAAAACTTAAAAGGGGTGGGAGGGGAAATTNTTTTTTTT
ATGTTTACTCAGTGAGTGTGTAGGGAAAAGCAAGGGNTAGACCCTAGACTNTNCTGATGC
ATCACTTATGATAGGGATACATTCCGAGAATGTGTCATTNAGTGATCCATCATTGTGCAA
CATCACAGATGCACTA
3' Read Nucleotide Sequence
>OriGene 3' read for AK093949 unedited
NGGGTATATCTTGNACCGCGCCGCAATCTANGATCGGTTTTTTTTTTTTTTTTTTGTATT
CCCTCAAATATTTAAGGGTTTGTTCTGAAAATACTTCATTAACTTGGAAATAGTTTAATC
TCTTCAAAATTTGCTTTTAAACTTTGTTAGGCTGGTCTAGAACAGCTGTTAGTCTAGATT
TTTCTTTTCTTTTCTTTTTGCCTCTGGTTCCAGTTCTTGTGATAGAATTAATTTGATCCC
ATTACTGTGGACTCTATTCAATGCCTGTCATGTTAAGAGGTATTTCCATACAGACTGGTG
AGAACATGAATGTTCTCTGTGTGAGCTCTGGAAACTGTTCTGTCTGCTGCTTTCCAGTGA
TTTTTTCCCTGACTTCCAGTAGTCTCCTCACACAAAAGGGCTGATCAACGCTCAGCTGCT
GACTCATGAGCAAGTCTATGCAGCTCCCCAGAGAGTTCTCTCTGTGCAGATCTTTCCTCT
CCAGTACTCTGACCTGCAAAATTATCGCCATCTCAGCCTCCTTGAAAGATGAACTTTGTT
TCTTCAACTCAACAACATCTCCAGCCTCTGTGTGCAGCCTGGAAATTCCATCCAGGCAGT
AAGGTGGAGTGCTCTTAGGGCCCATCTCATTTGTTTCCTTTCTTTCAGGGATCATTATCA
GCAGGGCTTGCTGTCCAACGTCTGAAAACCACTGTTTTAATATTTTGGCGGCTTTTTTTG
ACAGGGAGGTAAATCTAGTCCCTGTTACAGCTTTTTGCCTGAAGCCAAATCTTGTTGGGG
ATTTTAAGAATACCCCCCTAAATTAAATTTGGTTAAAAATATGGAAAAACCAACCTTTGA
ATTTAAACC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN AK093949
ORF Size 2274 bp
Insert Size 2000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 2274
RefSeq ORF 2274
Locus ID 11261
Cytogenetics 15q15.1
Protein Pathways MAPK signaling pathway, Calcium signaling pathway, Oocyte meiosis, Apoptosis, Wnt signaling pathway, Axon guidance, VEGF signaling pathway, Natural killer cell mediated cytotoxicity, T cell receptor signaling pathway, B cell receptor signaling pathway, Long-term potentiation, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS)
Gene Summary This gene encodes a phosphoprotein that binds to the Na+/H+ exchanger NHE1. This protein serves as an essential cofactor which supports the physiological activity of NHE family members and may play a role in the mitogenic regulation of NHE1. The protein shares similarity with calcineurin B and calmodulin and it is also known to be an endogenous inhibitor of calcineurin activity. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.