TAK1(MAP3K7) (NM_145331) Human Untagged Clone

CAT#: SC100191

MAP3K7 (untagged)-Human mitogen-activated protein kinase kinase kinase 7 (MAP3K7), transcript variant B

USD 969


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TAK1(MAP3K7) (NM_145331) Human Untagged Clone
Symbol MAP3K7
Synonyms MEKK7; TAK1; TGF1a
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_145331 edited
ATGTCTACAGCCTCTGCCGCCTCCTCCTCCTCCTCGTCTTCGGCCGGTGAGATGATCGAA
GCCCCTTCCCAGGTCCTCAACTTTGAAGAGATCGACTACAAGGAGATCGAGGTGGAAGAG
GTTGTTGGAAGAGGAGCCTTTGGAGTTGTTTGCAAAGCTAAGTGGAGAGCAAAAGATGTT
GCTATTAAACAAATAGAAAGTGAATCTGAGAGGAAAGCGTTTATTGTAGAGCTTCGGCAG
TTATCCCGTGTGAACCATCCTAATATTGTAAAGCTTTATGGAGCCTGCTTGAATCCAGTG
TGTCTTGTGATGGAATATGCTGAAGGGGGCTCTTTATATAATGTGCTGCATGGTGCTGAA
CCATTGCCATATTATACTGCTGCCCACGCAATGAGTTGGTGTTTACAGTGTTCCCAAGGA
GTGGCTTATCTTCACAGCATGCAACCCAAAGCGCTAATTCACAGGGACCTGAAACCACCA
AACTTACTGCTGGTTGCAGGGGGGACAGTTCTAAAAATTTGTGATTTTGGTACAGCCTGT
GACATTCAGACACACATGACCAATAACAAGGGGAGTGCTGCTTGGATGGCACCTGAAGTT
TTTGAAGGTAGTAATTACAGTGAAAAATGTGACGTCTTCAGCTGGGGTATTATTCTTTGG
GAAGTGATAACGCGTCGGAAACCCTTTGATGAGATTGGTGGCCCAGCTTTCCGAATCATG
TGGGCTGTTCATAATGGTACTCGACCACCACTGATAAAAAATTTACCTAAGCCCATTGAG
AGCCTGATGACTCGTTGTTGGTCTAAAGATCCTTCCCAGCGCCCTTCAATGGAGGAAATT
GTGAAAATAATGACTCACTTGATGCGGTACTTTCCAGGAGCAGATGAGCCATTACAGTAT
CCTTGTCAGTATTCAGATGAAGGACAGAGCAACTCTGCCACCAGTACAGGCTCATTCATG
GACATTGCTTCTACAAATACGAGTAACAAAAGTGACACTAATATGGAGCAAGTTCCTGCC
ACAAATGATACTATTAAGCGCTTAGAATCAAAATTGTTGAAAAATCAGGCAAAGCAACAG
AGTGAATCTGGACGTTTAAGCTTGGGAGCCTCCCGTGGGAGCAGTGTGGAGAGCTTGCCC
CCAACCTCTGAGGGCAAGAGGATGAGTGCTGACATGTCTGAAATAGAAGCTAGGATCGCC
GCAACCACAGCCTATTCCAAGCCTAAACGGGGCCACCGTAAAACTGCTTCATTTGGCAAC
ATTCTGGATGTCCCTGAGATCGTCATATCAGGCAACGGACAGCCAAGACGTAGATCCATC
CAAGACTTGACTGTAACTGGAACAGAACCTGGTCAGGTGAGCAGTAGGTCATCCAGTCCC
AGTGTCAGAATGATTACTACCTCAGGACCAACCTCAGAAAAGCCAACTCGAAGTCATCCA
TGGACCCCTGATGATTCCACAGATACCAATGGATCAGATAACTCCATCCCAATGGCTTAT
CTTACACTGGATCACCAACTACAGCCTCTAGCACCGTGCCCAAACTCCAAAGAATCTATG
GCAGTGTTTGAACAGCATTGTAAAATGGCACAAGAATATATGAAAGTTCAAACAGAAATT
GCATTGTTATTACAGAGAAAGCAAGAACTAGTTGCAGAACTGGACCAGGATGAAAAGGAC
CAGCAAAATACATCTCGCCTGGTACAGGAACATAAAAAGCTTTTAGATGAAAACAAAAGC
CTTTCTACTTACTACCAGCAATGCAAAAAACAACTAGAGGTCATCAGAAGTCAGCAGCAG
AAACGACAAGGCACTTCATGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_145331 unedited
GGGGGGNGNGGGGGGNNNNNNNNNNTTTTNNNNNNTTTTTTTCCCCCGCCCGNTGNCGCA
TTGGGCGGTAGGCGTGTACGGTGGGNAGTCTATATAAGCAGAGCTCATTTAGGTGACACT
ATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCGCGAATTCGGCACGAGGCCAGAGC
CGGACACGGCTGTGGCCGCTGCCTCTACCCCCGCCACGGATCGCCGGGTAGTAGGACTGC
GCGGCTCCAGGCTGAGGGTCGGTCCGGAGGCGGGTGGGCGCGGGTCTCACCCGGATTGTC
CGGGTGGCACCGTTCCCGGCCCCACCGGGCGCCGCGAGGGATCATGTCTACAGCCTCTGC
CGCCTCCTCCTCCTCCTCGTCTTCGGCCGGTGAGATGATCGAAGCCCCTTCCCAGGTCCT
CAACTTTGAAGAGATCGACTACAAGGAGATCGAGGTGGAAGAGGTTGTTGGAAGAGGAGC
CTTTGGAGTTGTTTGCAAAGCTAAGTGGAGAGCAAAAGATGTTGCTATTAAACAAATAGA
AAGTGAATCTGAGAGGAAAGCGTTTATTGTAGAGCTTCGGCAGTTATCCCGTGTGAACCA
TCCTAATATTGTAAAGCTTTATGGAGCCTGCTTGAATCCAGTGTGTCTTGTGATGGAATA
TGCTGAAGGGGGCTCTTTATATAATGTGCTGCATGGTGCTGAACCATTGCCATATTATAC
TGCTGCCCACGCAATNGAGTTGGTGTTTACAGTGTTCCCAAGGAGTGGCTTATCTTCACA
GCATGCAACCCANAGCGCTAATTCACAGGGACCTGAAACCACCAAACTTACTGCTGGNTG
CAGGGNGGGACAGTTCTAANAATTGTGATTNTGGTACAGCCTGTGACATTCAGACCACAT
GACCATACAAAGGGGAGTGCTGCCTGGATGCACCTGNAAGTTTTGAAGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_145331
ORF Size 1821 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_145331.1, NP_663304
RefSeq Size 2850
RefSeq ORF 1821
Locus ID 6885
Cytogenetics 6q15
Protein Families Protein Kinase, Druggable Genome
Protein Pathways MAPK signaling pathway, Wnt signaling pathway, Adherens junction, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway
Gene Summary The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase mediates the signaling transduction induced by TGF beta and morphogenetic protein (BMP), and controls a variety of cell functions including transcription regulation and apoptosis. In response to IL-1, this protein forms a kinase complex including TRAF6, MAP3K7P1/TAB1 and MAP3K7P2/TAB2; this complex is required for the activation of nuclear factor kappa B. This kinase can also activate MAPK8/JNK, MAP2K4/MKK4, and thus plays a role in the cell response to environmental stresses. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (B) encodes the longest isoform (B).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations