Rab22a (BC006596) Mouse Untagged Clone

CAT#: MC206782

Rab22a (untagged) - Mouse RAB22A, member RAS oncogene family (cDNA clone MGC:11709 IMAGE:3965264), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Rab22a
• Synonyms: 3732413A17Rik; AI662177; AW319644; AW550514; E130120E14Rik; Rab22
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for BC006596, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGCTGAGGGAACTTAAAGTGTGCCTGCTCGGGGATACGGGTGTGGGTAAATCGAGCATCGTGTGGC
  GGTTTGTGGAAGACAGTTTTGATCCGAATATCAATCCAACCATAGGGGCATCTTTTATGACCAAGACTGT
  CCAGTACCAAAATGAGCTACATAAATTCCTAATCTGGGATACAGCTGGACAAGAACGATTTCGTGCATTG
  GCACCAATGTACTATCGAGGGTCAGCAGCAGCCATCATCGTTTACGACATCACAAAAGAAGAGACGTTTT
  CAACTCTGAAGAACTGGGTGAGAGAGCTCCGCCAGCACGGCCCCCCCAGCATTGTCGTTGCCATCGCAGG
  GAACAAGTGCGATCTTACTGATGTCAGAGAAGTCATGGAGAGAGATGCTAAGGACTACGCAGATTCCATT
  CATGCCATCTTTGTAGAGACCAGCGCAAAAAATGCAATAAACATAAATGAACTCTTTATAGAAATTAGTC
  GAAGAATTCCATCCACTGATGCCAACCCAGCGTCTGGCGGCAAGGGCTTCAAACTCCGAAGACAGCCATC
  GGAGCCAAAGCGAAGCTGCTGCTGA
  
  
• Restriction Sites: RsrII-NotI
• ACCN: BC006596
• Insert Size: 585 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC006596, AAH06596
• RefSeq Size: 1911 bp
• RefSeq ORF: 585 bp
• Locus ID: 19334
• Cytogenetics: 2 97.26 cM
• Gene Summary: Plays a role in endocytosis and intracellular protein transport (PubMed:19759177, PubMed:27718357). Mediates trafficking of TF from early endosomes to recycling endosomes. Required for NGF-mediated endocytosis of NTRK1, and subsequent neurite outgrowth. Binds GTP and GDP and has low GTPase activity. Alternates between a GTP-bound active form and a GDP-bound inactive form (By similarity).[UniProtKB/Swiss-Prot Function]