Copz2 (NM_019877) Mouse Untagged Clone
CAT#: MC205815
Copz2 (untagged) - Mouse coatomer protein complex, subunit zeta 2 (Copz2), (10ug)
"NM_019877" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Copz2 |
Synonyms | 1110012D12Rik; zeta2-COP |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC025122
CGAGCGGAATGCAGCGGCCGGAGGCCTGGCCACGTCCGCACCCGGGGGAGGGGGCCTCAGCCGCCCAAGC CGGGGGCGCAGCGCCGCCCACCCGAGCCACGGAACAGCGGGAACCTTCTCTCTACACCATCAAGGCTGTC TTCATCTTAGATAATGACGGGCGAAGGCTGCTGGCCAAGTATTATGACGACACATTTCCCTCCGTGAAGG AGCAGATGGTTTTCGAGAAAAATGTCTTCAACAAGACCAGCCGCACCGAAAGTGAAATTGCATTTTTGGG GGGCATGACTATCGTCTACAAGAGCAGCATTGACATCTTCCTGTATGTGGTGGGATCTTCCTCCGAGAAT GAGCTGATGCTCATGTCTGTGCTTGCCTGCCTGTTTGACTCTCTGAGCCACATCTTAAGGAAGAACGTGG AGAAACGCTGGTTGCTGGAGAACATGGACGGAGCCTTCTTGGTGCTGGATGAAACTGTCGATGGAGGTGT GATTCTGGAGAGCGACCCCCAGCAAGTGATCCAGAAAGTGAATTTTAGGACTGATGACAGTGGCCTAACA GAACAGAGTGTGGCCCAGGTTCTTCAGTCAGCCAAGGAACAGATTAAATGGTCGCTATTGAAATGAAGAC CTTGGAATCAAGGCTCCTTCCCCAGAGAACTTTTGCCAGTCCCCGCGTAAGCCCCAAGATCTCAAGACGC AAGAGAGACCACTCTGCCTTCTCAGGCCTCTCTCAGAACTGATCCCTGAGGTCTCCTGCCAGGGATTCTG AGACGCAAAAGCTTGACCCCAGCTCCCTCACCCCTACTCAGCATCCTAACCTGGCCTTGGGGCCATGGGA ACCAGCAAAGTTGCCTCCCCTCGGACCTCTGACATCCTCAGTCCTAGGCCTTAATAAACTTACATTTTTC CCCCCCAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_019877 |
Insert Size | 618 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC025122, AAH25122 |
RefSeq Size | 936 bp |
RefSeq ORF | 618 bp |
Locus ID | 56358 |
UniProt ID | Q9JHH9 |
Cytogenetics | 11 D |
Gene Summary | The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. The zeta subunit may be involved in regulating the coat assembly and, hence, the rate of biosynthetic protein transport due to its association-dissociation properties with the coatomer complex (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202163 | Copz2 (tGFP-tagged) - Mouse coatomer protein complex, subunit zeta 2 (Copz2) |
USD 500.00 |
|
MR202163 | Copz2 (Myc-DDK-tagged) - Mouse coatomer protein complex, subunit zeta 2 (Copz2) |
USD 300.00 |
|
MR202163L3 | Lenti ORF clone of Copz2 (Myc-DDK-tagged) - Mouse coatomer protein complex, subunit zeta 2 (Copz2) |
USD 600.00 |
|
MR202163L4 | Lenti ORF clone of Copz2 (mGFP-tagged) - Mouse coatomer protein complex, subunit zeta 2 (Copz2) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review