Pclaf (NM_026515) Mouse Untagged Clone
CAT#: MC205369
2810417H13Rik (untagged) - Mouse RIKEN cDNA 2810417H13 gene (2810417H13Rik), (10ug)
"NM_026515" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Pclaf |
Synonyms | 2810417H13Rik; AA409629; mKIAA0101; Ns5apt9; Ns5atp9; p15(PAF); Paf; PAF15 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC021413
CCACGCGTCCGCAGTTGGGGTGACGGTGAAAGTTGTCTCTTCTTGTGTGAACATGGTGCGGACCAAAGCA AACTACGTTCCAGGAGCCTACAGAAAAGCGGTGGCTTCTCAAGCCCCTAGGAAGGTGCTTGGCTCCTCCA CCTTTGTCACCAATTCTTCAAGTTCGTCGAGAAAAGCTGAAAATAAGTATGCAGGAGGGAACCCAGTCTG TGTGCGCCCAACTCCCAAGTGGCAAAAAGGCATCGGGGAATTCTTCAGGCTGTCCCCTAAAGAGTCTAAA AAGGAAAACCAGGCTCCTGAAGAAGCAGGAACCAGTGGCTTAGGAAAAGCAAAGAGAAAAGCTTGTCCTT TGCAACCTGATCACAGAGATGATGAAAATGAATAGAATTTACTCATCTGAATAATGTCTCCGGTTTTTCT ACATTACTTACATGTAAATTTGGGTAAATGAGTTTGTCCAATTGGCTTGTTGAGGGGAAAAAAATTAGGC TAAAATTTAGCCATTCAAAAGAAACCAGATGTAAGAATGGAGAATTTTTATAATTTGTAAATTTGAATTG CATGCTTACACTTATGCCCTATGCTCCTCCTTTCTTACCTGTTAAAGCTTCTTCTTAAAGCCAACGTTCC CTGGCACTCTACTTGCTACTCTACGGTCTTTGCTTAGATTTTTGTACTGATGCCATTTTATGGGCAGTGA TTATGGAAATGACGCCATATTGTTATGGCATGTTTGCTTTAAAAATTTGACTTAGGCTGGGTGTGGTGGC GCACGCCTTTAATCTTTAAGAGTGAGTTCCAGGTCAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAA ACCAAAAAAAAAAAAAAAATTTGACTTAGTCTTTCTTACATTAAAATTTTCAATATTACCTAAAAAAAAA AAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_026515 |
Insert Size | 333 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC021413, AAH21413 |
RefSeq Size | 917 bp |
RefSeq ORF | 333 bp |
Locus ID | 68026 |
UniProt ID | Q9CQX4 |
Cytogenetics | 9 C |
Gene Summary | PCNA-binding protein that acts as a regulator of DNA repair during DNA replication. Following DNA damage, the interaction with PCNA is disrupted, facilitating the interaction between monoubiquitinated PCNA and the translesion DNA synthesis DNA polymerase eta (POLH) at stalled replisomes, facilitating the bypass of replication-fork-blocking lesions. Also acts as a regulator of centrosome number (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200414 | 2810417H13Rik (tGFP-tagged) - Mouse RIKEN cDNA 2810417H13 gene (2810417H13Rik) |
USD 350.00 |
|
MR200414 | 2810417H13Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2810417H13 gene (2810417H13Rik) |
USD 150.00 |
|
MR200414L3 | Lenti ORF clone of 2810417H13Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 2810417H13 gene (2810417H13Rik) |
USD 450.00 |
|
MR200414L4 | Lenti ORF clone of 2810417H13Rik (mGFP-tagged) - Mouse RIKEN cDNA 2810417H13 gene (2810417H13Rik) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review