Pclaf (NM_026515) Mouse Untagged Clone

CAT#: MC205369

2810417H13Rik (untagged) - Mouse RIKEN cDNA 2810417H13 gene (2810417H13Rik), (10ug)


  "NM_026515" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Pclaf"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Pclaf
Synonyms 2810417H13Rik; AA409629; mKIAA0101; Ns5apt9; Ns5atp9; p15(PAF); Paf; PAF15
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC021413
CCACGCGTCCGCAGTTGGGGTGACGGTGAAAGTTGTCTCTTCTTGTGTGAACATGGTGCGGACCAAAGCA AACTACGTTCCAGGAGCCTACAGAAAAGCGGTGGCTTCTCAAGCCCCTAGGAAGGTGCTTGGCTCCTCCA CCTTTGTCACCAATTCTTCAAGTTCGTCGAGAAAAGCTGAAAATAAGTATGCAGGAGGGAACCCAGTCTG TGTGCGCCCAACTCCCAAGTGGCAAAAAGGCATCGGGGAATTCTTCAGGCTGTCCCCTAAAGAGTCTAAA AAGGAAAACCAGGCTCCTGAAGAAGCAGGAACCAGTGGCTTAGGAAAAGCAAAGAGAAAAGCTTGTCCTT TGCAACCTGATCACAGAGATGATGAAAATGAATAGAATTTACTCATCTGAATAATGTCTCCGGTTTTTCT ACATTACTTACATGTAAATTTGGGTAAATGAGTTTGTCCAATTGGCTTGTTGAGGGGAAAAAAATTAGGC TAAAATTTAGCCATTCAAAAGAAACCAGATGTAAGAATGGAGAATTTTTATAATTTGTAAATTTGAATTG CATGCTTACACTTATGCCCTATGCTCCTCCTTTCTTACCTGTTAAAGCTTCTTCTTAAAGCCAACGTTCC CTGGCACTCTACTTGCTACTCTACGGTCTTTGCTTAGATTTTTGTACTGATGCCATTTTATGGGCAGTGA TTATGGAAATGACGCCATATTGTTATGGCATGTTTGCTTTAAAAATTTGACTTAGGCTGGGTGTGGTGGC GCACGCCTTTAATCTTTAAGAGTGAGTTCCAGGTCAGCCAGGGCTATACAGAGAAACCCTGTCTCGAAAA ACCAAAAAAAAAAAAAAAATTTGACTTAGTCTTTCTTACATTAAAATTTTCAATATTACCTAAAAAAAAA AAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026515
Insert Size 333 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC021413, AAH21413
RefSeq Size 917 bp
RefSeq ORF 333 bp
Locus ID 68026
UniProt ID Q9CQX4
Cytogenetics 9 C
Gene Summary PCNA-binding protein that acts as a regulator of DNA repair during DNA replication. Following DNA damage, the interaction with PCNA is disrupted, facilitating the interaction between monoubiquitinated PCNA and the translesion DNA synthesis DNA polymerase eta (POLH) at stalled replisomes, facilitating the bypass of replication-fork-blocking lesions. Also acts as a regulator of centrosome number (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.