Cryga (NM_007774) Mouse Untagged Clone
CAT#: MC205177
Cryga (untagged) - Mouse crystallin, gamma A (Cryga), (10ug)
"NM_007774" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Cryga |
Synonyms | Cryg-; Cryg-4; DGcry-; DGcry-4; Sec; Secc |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC056430
GCTGTCAACAACGATGGGAAAGATCACCTTCTACGAGGACCGCGGCTTCCAGGGCCGCTGCTATGAGTGC AGCAGCGACTGCCCCAACCTGCAGACCTACTTCAGCCGCTGCAACTCCATCCGTGTGGACAGTGGCTGCT GGATGCTCTATGAGCGCCCCAACTACCAGGGCTACCAGTACTTCCTGCGTCGCGGGGACTACCCTGACTA CCAGCAGTGGATGGGTTTCAGCGACTCCATCCGCTCCTGCCGTTCCATTCCATACACCAGCTCTCACAGG ATAAGGCTTTATGAGAGAGATGACTACCGGGGCCTTGTGTCTGAGCTCATGGACGACTGTTCCTGCATCC ACGATCGCTTCCGCCTCCATGAGATCTACTCCATGCACGTGCTGGAGGGCTGCTGGGTCCTCTATGAGAT GCCCAACTACCGAGGCCGCCAATACCTGCTCAGGCCTGGAGACTACAGGCGCTACCACGACTGGGGCGCC ATGGATGCCAAGGTCGGCTCTCTGAGACGGGTCATGGATTTGTACTAAGCCTCCTTTTGCTTGTTACAGC CCATATATGCAATAAATAATCAACCTGTGTTCCTGGCAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | AscI-NotI |
ACCN | NM_007774 |
Insert Size | 525 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC056430, AAH56430 |
RefSeq Size | 617 bp |
RefSeq ORF | 525 bp |
Locus ID | 12964 |
UniProt ID | P04345 |
Cytogenetics | 1 32.84 cM |
Gene Summary | Three main families of major soluble proteins, the alpha, beta and gamma crystallins, are ubiquitously expressed in vertebrate lenses. This gene encodes a member of the gamma-crystallin family of proteins which may function as a structural component of the eye lens. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Five gamma-crystallin genes (gamma-A through gamma-E) are tandemly organized in a genomic segment as a gene cluster in the mouse. Another gamma-crystallin gene (gamma-F) is found some distance upstream of the cluster on the same chromosome. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201507 | Cryga (tGFP-tagged) - Mouse crystallin, gamma A (Cryga) |
USD 500.00 |
|
MR201507 | Cryga (Myc-DDK-tagged) - Mouse crystallin, gamma A (Cryga) |
USD 300.00 |
|
MR201507L3 | Lenti ORF clone of Cryga (Myc-DDK-tagged) - Mouse crystallin, gamma A (Cryga) |
USD 600.00 |
|
MR201507L4 | Lenti ORF clone of Cryga (mGFP-tagged) - Mouse crystallin, gamma A (Cryga) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review