Lrtm2 (NM_172492) Mouse Untagged Clone

CAT#: MC205156

Lrtm2 (untagged) - Mouse leucine-rich repeats and transmembrane domains 2 (Lrtm2), transcript variant 1, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Lrtm2 (NM_172492) Mouse Untagged Clone
Symbol Lrtm2
Synonyms A230084J22; AI841794
Vector pCMV6-Kan/Neo
Sequence Data
>BC058944
TCTACCTCTCCCCCTCTTCGGTCTGTCTTCCTCCCGCCCTCCCTCTTTCGCTTCAGTTTGTCGCTGACCC CGCAGCCCCCTCCCCGGCAGCGGCAGCTCAGCCTGCGGGTCCGCCTCCTTCACAGGCGCTGCCCAGTCTC CCGCTGCCCTGAACCAGACCGGACATCCCTGCGTTCTGCCTGCCAAGCTGCCCGTGTGTCCGGCTACCTG GTCTGAGCATCAGGTCCCGGTGCAAAAAGGTCGTTGTGTCTCTCAGGCCAGCAGCAGAAGAGCAGGAAGC CCTGACCTGCGGGAGTTATAAATCGGCCAGCTGGCAGAAGACCAAGCTTGTAATTCACCTCAAGGTGATA GTGGGCTCAGAGGCAGGGGGTGGTGCAGCAGCTCACTCCCTACCTGTCAGCAGCAGCTACAAGGGAAGGG CCTCGCCTCTGCCTCCCCACAGCTATGGTAAGCTGGGCATTGGGGAGAATGACGGGACTGGTACATCTAG ATGGAGGGGCACAGGTGGGAGCTGGGGTCTCACTCATTTACCTAGGAGAGATGCACCTTCATTTCTCCCC TGTGGTAAGCTTGGGGTGGTGGTAGTGGTGGTGGAGGAAGTGATATTGCAAGGGGATAATTTTTAAAGCC CCCCAGAGTGCAAAGAGGCCTCAGGGGAGTGAGGGAAAGACAGGGGGTTTAGGGGGCTGAGCTGGGGTTC AGCTGGCAGTTCTTGTGCCTTCCAGCCCACTTCTAGGACTGCTAGATCCTCTTGACCCCCTTCTTGCAGG AGCAACAGGAGAGGGAGTGAAGAATTGTAAAGAGACACCTAGGCCTTGTCCCTGACCCCTGGGCTGGAAC GGGCATCAAATGCTTTGCTCTCTCTCTCAGGACTGACACGTGGCACATGCTGAGGGGCTCTCTCCAGAGC TGCGGAGAGTGTGGGTTTCACCATGTTGGCACCAGGCGGTGGCCCAGAGCAGAGGAGCAAGCTTGTCCTG CAATGGAGGCAGGTCTCCTGGATCACCTGCTGGATTGCCCTGTGTGCTGTGGAGGTGATCCCTGCCTGCC CCTTCTCCTGCACATGTGACAGTCGCAGCTTGGAGGTGGACTGCAGTGGCCTGGGTCTCACCACTGTACC CCCGGATGTGCCCGCGGCCACCCAAAGCCTTTTGCTCCTGAACAATAAGCTGAGTGCCCTACCAAGCTGG GCATTCGCCAACCTGTCCAACCTGCAGCGACTGGACCTGTCCAACAACTTTCTTGACCAGCTCCCCCGGT CCATTTTCGAGGACTTGGTCAATCTGACAGAGCTCCAGCTTCGGAATAACAGCATCAGGACCCTGGACAG GGACCTGCTCCAGCACTCCCCACTACTTAGACATCTGGATTTGTCTATCAACGGCTTGGCCCAGCTGCCC CCGGGGCTTTTTGATGGGCTCCTGGCTCTGCGCTCCTTGTCCCTCCGCTCCAATCGTCTGCAGAGCCTGG ACCGGCTGACGTTCGAGCCCCTGGCAAGCCTGCAGCTGCTTCAGGTTGGGGACAACCCGTGGGAGTGTGA CTGCAACCTTCGGGAATTCAAACACTGGCTGGAGTGGTTCTCCTACAGAGGGGGTCGCCTGGATCAGCTT GCCTGTACCCTACCCAAGGAGCTAAGGGGGAAGGACATGCGTGCGGTCCCCATGGAGATGTTTAACTACT GTTCCCAGCTAGAGGATGAGAACAACTCTGCTGGGCTAGATGCTCCAGGACCACCCTGCACCAAGGCCAG CCCGGAGCCTCCTAAACCTAAGCCTGGGGCTGAGCCTGAGCCCGAACCCAGCACTGCCTGCCCACAGAAG CAGAGGTACCGGCCCGTGAGTGTGCGGCGAGCCATTGGCACAGTGATCATCGCCGGGGTCGTGTGTGGCA TTGTCTGCATCATGATGGTGGTGGCCGCTGCTTACGGCTGCATCTACGCATCTCTCATGGCCAAGTACCA CCGTGAGCTCAAGAAGCGCCAGCCGCTGATGGGGGACCCTGAGGGTGAGCATGAAGATCAGAAGCAGATC TCGTCTGTGGCATGAGAGCTGTCTGTCTGGCCCAGGTAGGACAGCAAGGAGACTCCATGGGACTGCTACC AAAAGGGCTGCCCTTCCCTCCATCACAGGCCCCGTCTCAGCCTGACACTGGGACTGCCTCCCTCAGCTCC CTCGTCCCAATCTCTTTCCAAGTTTCCCAGAGGCTTCCCTCGGGCCAAAGATTCCCGTGGAAGGTCTTCT CTGGGCCTCTTGTCTTTGGAACCCCTGAGCCTCGCTGTAGGCTTCTGGCCACAGGGAGGAAAGAACCTAC TCTAGAGACATCATCTGCACTGAGCACTTCCCTCCTGCCCAGGGCTGCCAGAGCTGGTGACTCTCCCTAC CTCTTTCTCATTCCCACTTCAGTCTGCATTAGGGCCTGGGAGGGAGGGACAGGAGGCCCAAAGGTAGATT TCTGTGACTCCTTTTAAAGCCAGAAAGATGTCTCAAGTCTTTTGCAGTGTGAAGCTTGTCCAGCTCTTAG CCAATGTGAAACCACCCCAGTCCTGTGATCTGGGTCCAATGTTTAGAAAAACCAAAGTGGCTATAATGTC CCCCTTGGGTGGATGTCATTATGTCCCTTTATTGGCTATAGACTCCTCTGACTACATTGCTCCAGGTTTA CGAATTCTATCCATACTTTTTGTTCTAGCGTGAGGTTTTGAGACAGGGCCTTACTCTATATACTAATTCC TCTGTCAGGCAGGGCATCAAAGTCACACACACACACACACACACACACAGACACACACACACATCATGAG AACTTGGGGCAGAGGCCTGCTATCCCCTGAGCCCAGAGGCCACAGCCCCTCTTACTTCCTGACTACAGTC TTCCCATGTCATCAGGGGTTGGGTCCTGGACGACAACACAGGGATCCTTTGAGACCCTCTTAAGTGGGCC AAAGTATGCAGCTGGAGAAATTGCATTGTCCTGGCAGCCCTAGCACCTCTCTTGCTAGGTTTACCAGAAG GGTGCACATATGCATGACGGGTTCCAGGCGTCTGAGAGCTCTGTTGCAGACCCCCGGGCATGCCTAGGAA CCTCTTCCCTGCAGGTTCCAGGTACACGCAGCAGTTTCTACCCCTGCAGCCTGGCTTCTCCTGTCTCCTC TGTCATCTGCATCATTTGTGCATGACCTCAGAGACTGGGTCTGGGCTGTGCTCTGAGTTTGGTGTTTCAC CTTAAGGAAAGCAGATGTCAGGCAGTAAGTCCTTGAGAAGGCTGGCTGCCTTCAACACATCCCCGACAGA CTGCAGGAACAGGGACAGGATGGCTACATTCTGTTCAGAGTCCTTGACGGTGGGGCTTTCTTTCCCAGGG GTTCATCGGCTGCCTGGTTTCCTGGGAGTGTGCAATCGCACCTGGACTACCCAGGCTAAAAAAATGGCTG CAGTCCTATCTGGTTTGGAGATTCTTGCCCCTGGGCTGTGCACATTTTCAAGGTCACTGCTCTCTGTTCT AAACTGTCCCCTCCTTAGAGACTAGATACCTCTGTAGGAGATGCCAGACTGATACCTTACCCTGGGAAGG TCTTGGTAGTAGCCAGGAACACACTTAGGCACTGACTATACACCTATGAGGGCCTCAGGGCAGCCTCTCA GCCCTCCTTCTTGTCCTCGGCCACCTATTCGACTAGCAGGGGTGAGTACTGGAAGTCTCAGAAGAGCCTC CAAGGTTGTTCTCTGGCAGGTAGACAGAGAGCACCGGCTGCTGTTCAGGATCACAGGATCCTCTAGGCTG GGCCACAGTCTTCCTTCCTCTTTTGACTGGTGGGCCAATCCCAGAGCTGGGATTTTCTAAGGGCCTGGGG GAGGGAGGGTGTTGTCAGTGGTGATATCTTTAGCCTGAGACAGAAGATTTTTAAAGGCAAAATTATATTT CTGGTTTGTCGTTTCAGAAGACCAATAAAGACTATTTTCCTATGTAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN NM_172492
ORF Size 1113 bp
Insert Size 1113
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC058944, NP_766080
RefSeq Size 4021
RefSeq ORF 1113
Locus ID 211187
Cytogenetics 6|6 F1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.