Ssbp1 (NM_212468) Mouse Untagged Clone
CAT#: MC204982
Ssbp1 (untagged) - Mouse single-stranded DNA binding protein 1 (Ssbp1), nuclear gene encoding mitochondrial protein, transcript variant 1, (10ug)
"NM_212468" in other vectors (3)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ssbp1 |
Synonyms | 2810480P10Rik; G630031O20Rik; mtDBP; MtSSB |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC061183
GCTGGCGGTCGGGCTCTGCGTGTCCGGAAAAGCCTAAAGATTAGGTTGTAAGAAAAACAGAAGCCATGTT TCGAAGACCTGTGTTACAGGTATTTCGTCAGTTTGTAAGACATGAGTCTGAAGTAGCCAGCAGTTTGGTT CTTGAACGATCTCTGAATCGTGTTCAGTTACTTGGACGAGTAGGTCAGGACCCTGTCATGAGACAGGTGG AAGGAAAAAACCCAGTCACAATATTTTCTCTAGCAACAAATGAGATGTGGCGATCAGGGGATAGTGAAGT ATACCAAATGGGTGACGTTAGTCAGAAGACGACGTGGCACAGAATATCAGTGTTTCGACCAGGCCTCAGA GATGTGGCATATCAGTATGTGAAAAAGGGGGCTCGTATATTTGTGGAAGGGAAAGTGGACTATGGCGAGT ACATGGATAAAAACAATGTGAGGCGGCAAGCAACAACAATCATAGCTGATAACATTATATTTCTGAGTGA CCAGACAAAAGAAAAGGCATAGAACGGATGATTCGTCTTTGATCATTGTTTGGTACAGTCTCCTTTGCAA ATCATGTATAGTCTATAGTTTAAAGATAAAAATTAAATTTTTTATATCAAAAAAAAAAAAAAAAAAAAAA AAAAAAAA |
Restriction Sites | SfiI-SfiI |
ACCN | NM_212468 |
Insert Size | 447 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC061183, AAH61183 |
RefSeq Size | 638 bp |
RefSeq ORF | 447 bp |
Locus ID | 381760 |
UniProt ID | Q9CYR0 |
Cytogenetics | 6 B1 |
Gene Summary | This protein binds preferentially and cooperatively to ss-DNA. Probably involved in mitochondrial DNA replication. Associates with mitochondrial DNA (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) includes an alternate 3' terminal exon, compared to variant 1. Variants 1, 3, and 5 encode the same isoform (1) which is shorter and has a distinct C-terminus, compared to isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR201027 | Ssbp1 (Myc-DDK-tagged) - Mouse single-stranded DNA binding protein 1 (Ssbp1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 150.00 |
|
MR201027L3 | Lenti ORF clone of Ssbp1 (Myc-DDK-tagged) - Mouse single-stranded DNA binding protein 1 (Ssbp1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 450.00 |
|
MR201027L4 | Lenti ORF clone of Ssbp1 (mGFP-tagged) - Mouse single-stranded DNA binding protein 1 (Ssbp1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review