U2af1l4 (NM_170760) Mouse Untagged Clone

CAT#: MC204955

U2af1l4 (untagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4), (10ug)


  "NM_170760" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "U2af1l4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol U2af1l4
Synonyms AA407033; AF419339; AI451269; AW553050; U2af26
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC060972
GAGTGTTCGGGTAAAAATGGCTGAATATTTAGCTTCGATATTCGGGACTGAGAAGGACAAGGTTAACTGC TCTTTTTACTTTAAGATTGGAGCCTGCCGGCACGGGGACCGGTGCTCCCGACTTCACAACAAACCGACTT TCAGCCAGACCATAGTCCTGCTCAACTTGTACCGGAATCCACAGAACACAGCCCAAACTGCAGATGGATC ACACTGTCACGTGAGCGACGTGGAGGTGCAAGAACACTATGATAACTTCTTTGAGGAGGTATTCACAGAA CTGCAGGAGAAGTATGGAGAGATTGAAGAGATGAATGTGTGTGACAACCTCGGGGACCACCTCGTGGGCA ATGTCTACGTTAAGTTCCGGCGGGAGGAGGATGCAGAGCGGGCTGTAGCGGAACTCAATAACCGCTGGTT CAACGGGCAGGCTGTGCATGCCGAGCTGTCTCCTGTCACTGACTTCCGAGAGTCCTGCTGCCGGCAGTAT GAGATGGGGGAATGCACCCGAGGTGGCTTCTGCAACTTTATGCACCTACGGCCCATATCTCGGAACTTGC GCCGGCAGCTCTATGGGCGAGGACCCAGGCATAGGTCACCTCCAAGGTCCCACACAGGTCACCGTCCCCG AGAAAGGAACCGACGTCGTTCCCCAGACCACCGGCATGGTCGCTTCTGAGACGGGTCCCCTTGCTCTCCA CCCAAGGGCATAGATGTTCCTGTCCAGCGTCCCTTTTCAAAGTGCCCTTCACTCTCCAGTCCCAGCATCC CCAGGCTTCGGAGCTTCATAATATAATCTGTTCGACACAGGAACCTCCTCCTCCTGTCCCTCCTCCAATA AAGGTTAAGAAGTTTGTCAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI     
ACCN NM_170760
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC060972, AAH60972
RefSeq Size 892 bp
RefSeq ORF 663 bp
Locus ID 233073
UniProt ID Q8BGJ9
Cytogenetics 7 B1
Gene Summary RNA-binding protein that function as a pre-mRNA splicing factor. Plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3'-splice site selection. It can functionally substitute for U2AF1 in constitutive splicing and enhancer-dependent splicing. Acts by enhancing the binding of U2AF2 to weak pyrimidine tracts. Also participates in the regulation of alternative pre-mRNA splicing. Activates exon 5 skipping of PTPRC during T-cell activation; an event reversed by GFI1. Binds to RNA at the AG dinucleotide at the 3'-splice site. Shows a preference for AGC or AGA (PubMed:11739736, PubMed:16819553, PubMed:18460468). Alternative splicing of U2AF1L4 may play a role in connecting the circadian rhythm to changing external cues: may provide a circadian buffering system in central and periphery clocks that allows synchronized adaption to clock-resetting stimuli in order to prevent potentially pathogenic desynchronization (PubMed:24837677).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.