Bckdhb (NM_199195) Mouse Untagged Clone

CAT#: MC204787

Bckdhb (untagged) - Mouse branched chain ketoacid dehydrogenase E1, beta polypeptide (Bckdhb), nuclear gene encoding mitochondrial protein, (10ug)


  "NM_199195" in other vectors (3)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Bckdhb"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bckdhb
Synonyms BCKDE1B; BCKDH E1-beta
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC064099
CAGAATTGGATGGCTGAATTTGAACAGATCCTTCGGGAATTGAGACTTCAGGTCAACTCCACGCGCTTGG ACCTGTCGCTGACCAAAGGATTACCCAATTGGATCTCCTCAGCATTTTCTTTCTTTAAAAAATAGGGCAA ACTCAGAAGATGAACCTCTTCCAGTCAATAACAAGTGCCCTGGATAACTCATTAGCCAAAGACCCCACTG CAGTAATATTTGGTGAAGATGTTGCCTTTGGTGGAGTCTTCCGATGCACTGTTGGTTTACGAGACAAATA CGGAAAAGATAGAGTGTTTAACACCCCGTTGTGTGAACAAGGAATAGTTGGATTTGGCATTGGAATCGCG GTCACCGGTGCTACAGCTATTGCGGAAATCCAGTTTGCCGACTATATTTTCCCTGCCTTTGATCAGATTG TCAACGAAGCTGCCAAGTATCGCTACCGCTCAGGTGATCTTTTCAACTGTGGGAGCCTCACCATCCGGGC CCCGTGGGGTTGTGTGGGCCATGGGGCTCTCTACCATTCTCAGAGTCCTGAAGCCTTTTTTGCCCATTGC CCAGGGATCAAGGTGGTAATACCCCGAAGCCCTTTCCAGGCCAAGGGACTTCTGTTGTCATGCATAGAAG ATAAAAATCCATGTATATTTTTTGAACCTAAAATACTTTACCGGGCAGCAGTGGAACAGGTCCCAGTAGA ACCCTACAAGATCCCCTTGTCTCAGGCTGAAGTCATCCAGGAGGGCAGCGATGTGACTCTGGTTGCCTGG GGCACTCAGGTTCATGTCATCCGGGAGGTGGCTTCCATGGCCCAAGAAAAGCTTGGAGTATCTTGTGAAG TCATCGATCTGCGGACAATTGTGCCTTGGGATGTGGATACAGTTTGCAAGTCTGTGATCAAAACCGGGCG ACTGTTGATCAGCCACGAGGCTCCCTTAACAGGCGGCTTTGCCTCTGAGATCAGCTCCACGGTCCAGGAA GAATGTTTCTTGAACCTAGAGGCTCCAATATCTCGAGTTTGCGGATATGACACCCCGTTTCCTCACATCT TTGAGCCCTTTTATATCCCAGACAAATGGAAGTGCTACGATGCCCTTCGCAAGATGATCAACTATTGACG ACAGAGAAAACCAGGAAGATCATGACCAGACATGGAAATATTTTTCTGAAACCTTTTTATATTTCCTTAT ACTTCTTTCTTCTTACATATAGTTTTATGCAACGAACTGTCATGGATATTGGCTGATGAGCTGCGAATTA CTTATCATGTTAATATAAATGGATTGAGTGCACAGGAGGAATGCTTTAAGGAGTGCGTGGGCGGTGATCT TAAGACTGTTTCATGACTATAAATACCGGGTGGTGTTGTATTCAATAAAGCCAAATTACATCGCCTCAAA AAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI     
ACCN NM_199195
Insert Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC064099, AAH64099
RefSeq Size 1419 bp
RefSeq ORF 969 bp
Locus ID 12040
UniProt ID Q6P3A8
Cytogenetics 9 E2
Gene Summary This gene encodes the beta chain of the branched chain alpha ketoacid dehydrogenase (Bckdh) complex. The encoded protein exists in a heterotetrameric complex containing the Bckdh alpha subunit to form the E1 catalytic component of Bckdh complex. The Bckdh complex catalyzes the oxidative decarboxylation of branched chain ketoacids to their corresponding acyl-CoA esters, during the catabolism of leucine, isoleucine and valine. In humans, certain mutations in this gene cause maple syrup urine disease. Alternative splicing results in multiple transcript variants encoding different isoforms. A pseudogene for this gene has been identified. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon and uses a downstream start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.