Snrpa1 (NM_021336) Mouse Untagged Clone
CAT#: MC204536
Snrpa1 (untagged) - Mouse small nuclear ribonucleoprotein polypeptide A' (Snrpa1), (10ug)
"NM_021336" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Snrpa1 |
Synonyms | 1500015N06Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC029642
GCAGGCCGGTGTCGGAGGTGAGGGTCCGCGGGCTGCGACAGGATGGTGAAGCTCACGGCGGAGCTGATCG AGCAGGCGGCGCAGTACACAAATGCTGTGCGGGACCGTGAACTGGACCTCCGGGGATATAAAATTCCGGT TATTGAGAATCTGGGTGCCACCTTAGACCAGTTTGATGCTATTGATTTTTCTGACAATGAGATCCGGAAA CTGGATGGTTTCCCTTTGTTGAGAAGACTGAAAACATTATTAGTGAACAACAACAGAATTTGCCGTATAG GTGAGGGACTTGACCAGGCTCTTCCCTGTCTGACAGAGCTCATCCTCACCAACAACAGTCTAGTGGAACT GGGTGATCTGGACCCGTTGGCATCTCTCAAATCACTGACATATCTAAGCATCCTAAGAAACCCTGTAACC AATAAGAAGCATTATCGACTTTATGTGATTTATAAAGTTCCACAAGTCAGAGTACTGGACTTTCAGAAAG TGAAACTCAAAGAGCGTCAGGAAGCAGAGAAAATGTTCAAGGGCAAACGGGGTGCACAGCTTGCAAAGGA TATTGCCAGGAGAAGCAAAACTTTTAATCCAGGTGCTGGTTTGCCAACTGACAAAAAGAAAGGCGGGCCA TCTGCAGGGGATGTGGAAGCAATCAAGAATGCCATCGCAAACGCGTCGACGCTGGCTGAGGTTGAGAGGC TGAAGGGCTTGCTGCAGTCGGGCCAGATACCTGGCAGAGAGCGCAGATCAGGGCCGAGTGATGAGGGTGA AGAAGAGATAGAAGACGACACAGTCACAAATGGGTCCTGAGCTCTGCCAGATGCTCTGATAAGCTCTCTT GGGACAAGTCTTGCATTTTGAGCATGGAGTAACAACCTTGCTTGTATCAGCAACGTGGACTCTCAGCTTT GCTGAATGTTCAGAACGACTGGTGATAATTTTTTAATATGAACCTTGAAATAACAATGCCAGTTTTCTAC AAATGGTAAAATAAAGGCGACTTACTGTGCTGAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_021336 |
Insert Size | 768 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC029642, AAH29642 |
RefSeq Size | 1030 bp |
RefSeq ORF | 768 bp |
Locus ID | 68981 |
UniProt ID | P57784 |
Cytogenetics | 7 C |
Gene Summary | Involved in pre-mRNA splicing as component of the spliceosome. Associated with sn-RNP U2, where it contributes to the binding of stem loop IV of U2 snRNA.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203278 | Snrpa1 (tGFP-tagged) - Mouse small nuclear ribonucleoprotein polypeptide A' (Snrpa1) |
USD 500.00 |
|
MR203278 | Snrpa1 (Myc-DDK-tagged) - Mouse small nuclear ribonucleoprotein polypeptide A' (Snrpa1) |
USD 300.00 |
|
MR203278L3 | Lenti ORF clone of Snrpa1 (Myc-DDK-tagged) - Mouse small nuclear ribonucleoprotein polypeptide A' (Snrpa1) |
USD 600.00 |
|
MR203278L4 | Lenti ORF clone of Snrpa1 (mGFP-tagged) - Mouse small nuclear ribonucleoprotein polypeptide A' (Snrpa1) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review