Polr2f (NM_027231) Mouse Untagged Clone

CAT#: MC204220

Polr2f (untagged) - Mouse polymerase (RNA) II (DNA directed) polypeptide F (Polr2f), (10ug)


  "NM_027231" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Polr2f"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Polr2f
Synonyms 1810060D16Rik; RPB6
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024419
GGCAAAGGCGCGCGTTCTCTGCTCTGCGCCCCGGGCGGAGAAGGCATCATGTCAGACAACGAGGACAATT TCGACGGCGACGACTTTGATGACGTTGAGGAGGACGAAGGACTTGACGACTTGGAAAATGCTGAGGAGGA GGGCCAGGAAAATGTCGAGATTCTCCCATCTGGTGAGCGACCACAGGCCAACCAGAAGCGGATCACCACT CCTTACATGACCAAGTATGAGCGTGCCCGAGTGCTGGGCACCCGGGCTCTTCAGATCGCGATGTGTGCCC CGGTGATGGTGGAGCTGGAGGGGGAGACAGACCCTTTGCTCATCGCCATGAAGGAACTCAAGGCGCGGAA GATCCCCATCATCATTCGCCGGTACCTGCCAGACGGCAGCTATGAGGACTGGGGCGTGGACGAGCTTATC ATCAGCGACTGAGCCGGGCGCGCTCGGCCTGCACCAGCTCTGCTGGGCACCCTCTCTGTGCCCGTTTTAT ATGTGTAAATAATAAACCTCACCCTTTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_027231
Insert Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC024419, AAH24419
RefSeq Size 612 bp
RefSeq ORF 384 bp
Locus ID 69833
UniProt ID P61219
Cytogenetics 15 37.7 cM
Gene Summary DNA-dependent RNA polymerases catalyze the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Common component of RNA polymerases I, II and III which synthesize ribosomal RNA precursors, mRNA precursors and many functional non-coding RNAs, and small RNAs, such as 5S rRNA and tRNAs, respectively. Pol II is the central component of the basal RNA polymerase II transcription machinery. Pols are composed of mobile elements that move relative to each other. In Pol II, POLR2F/RPB6 is part of the clamp element and together with parts of RPB1 and RPB2 forms a pocket to which the RPB4-RPB7 subcomplex binds (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.