Rgs17 (NM_019958) Mouse Untagged Clone

CAT#: MC202729

Rgs17 (untagged) - Mouse regulator of G-protein signaling 17 (Rgs17), transcript variant 2, (10ug)


  "NM_019958" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rgs17"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rgs17
Synonyms 6430507P11Rik; Rgsz2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC064782 sequence for NM_019958
CGGATGGCACGGAGCCTGCTCCGCTAGAGGACGGAGCAGCCCACTCTCGAGCACCCTCGGACCCGGACCC CGGAGCTCTCGCCCACATCTAAGTCTACCCGGCAGTTGGGTTCTGAAGCAGCTGACATGAGAAAACGGCA GCAGTCACAAAATGAAGGAACACAGGCTGTGTCTCAAGCGCCTGGAAACCAAAGGCCCAACAATACCTGC TGCTTCTGCTGGTGCTGTTGCTGCAGCTGCTCCTGCCTCACTGTCAGGAATGAGGAAAGAGGAGACTCTT CGGGGAGATCCCCACATACCACCAAAATGGAGAGCATCCAGGTCCTAGAGGAATGCCAAAACCCCACTGC AGATGAAGTCTTGTCCTGGTCTCAGAATTTTGACAAGATGATGAAGACTCCTGCAGGAAGAAACCTTTTC CGAGAGTTCCTCCGAACGGAGTACAGTGAAGAGAACCTACTCTTCTGGCTGGCCTGTGAAGACTTAAAGA AGGAGCAGAACAAAAAGGCTGTTGAAGAAAAGGCCAGGATGATATACAAGGATTACATTTCTATACTGTC ACCGAAAGAGGTCAGCCTGGATTCTCGAGTTAGAGAGGTGATCAACAGGAGTCTGCTGGACCCCAGCCTA CACATGTATGAAGACGCCCAGCTTCAGATCTACACCCTAATGCACAGAGATTCTTTCCCAAGATTCTTGA ACTCACAGATCTATAAAGCTTTTGTGGAAAGTACCACCAGCTGTACTTCTGAATCCTAATTTTCAGTTGA CAGGCCAAAAAAAAAAAAAAAATCCATTTCAGAGGGCTGGGATGGGAAATAAAAGTAATTAAATAACACC AGAAATTGAGTTCCTGAAAAACTACAGGTTGACTGCTGGGGAAATACAATGAGGAAGGTCTCTTGTCTCC ATTTTTATCAAGGTTATCCATGATTCTGTTTGGGGCAACAACAACAAAAAAAGCCTATATGAGACAATGA ATTGCCAAATTAAGTTTGTTTGATTCAACACTTGCTCTACTTGCAAGCAAATTGTGTTCCTAGTCCTCTG AACAATCCCCTAGTGCATCTCTAGAGGCCGCATGTGCAAAGTAAAACTGCTTCGTCTGCCCTTTACTTGT GCTATTAAATCAGTAGCATACCTTGTATCTGTATTTAAGGACTTTTGTGCAATATGGTCTCTTAGAAACA ATTGCCAACAAATTGGCCGTGGTTTGCATTTTTTAAAAGCATAATCCAATACACACAAAGGCTATTTTAA ACATGTAACAGTGATATTTAACCATGCTACATACTGTGTTTAGTATACCGTCTCTGAAGCCAATTTTTCT GTACATGTTTAAAAAAAATAGAAGCTGTTAAAGGATCTTACTGTGTGAGCCCTCTGGTTGTTCACTGCCC AAATTCTGGCATTTTTGTTACAGAAGAGTTTACTATATAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGA AAGAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019958
Insert Size 633 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC064782, AAH64782
RefSeq Size 1487 bp
RefSeq ORF 633 bp
Locus ID 56533
UniProt ID Q9QZB0
Cytogenetics 10 A1
Gene Summary Regulates G protein-coupled receptor signaling cascades, including signaling via muscarinic acetylcholine receptor CHRM2 and dopamine receptor DRD2 (By similarity). Inhibits signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound form. Binds selectively to GNAZ and GNAI2 subunits, accelerates their GTPase activity and regulates their signaling activities. Negatively regulates mu-opioid receptor-mediated activation of the G-proteins.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks the exon containing the translation start codon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.