Sult1b1 (NM_019878) Mouse Untagged Clone
CAT#: MC201834
Sult1b1 (untagged) - Mouse sulfotransferase family 1B, member 1 (Sult1b1), (10ug)
"NM_019878" in other vectors (5)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Sult1b1 |
Synonyms | ST1B1; St2b2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024361 sequence for NM_019878
CACTTGTCACACAGAACCTGATTTTTACTCCTTCTATTCCTTCTGTTCAGCCTGCTGCAAAAATGAGTGC CTCAGAAGACGTTTGGAGAAAAGATCTGAAGATGATCCATGGCTACCCCATGATCTATGCTTTTGCACTC AATTGGGAAAGGATTGAAGAGTTCCAGAGCACACCAGGTGACATTGTAATAACCACTTACCCTAAATCAG GTACTACTTGGCTTAGTGAGATTGTAGACATGGTTCTAAATGATGGAAATGTTGAAAAATGTAAGAGAGA TGTTATCACCTCCAAAGTTCCAATGTTGGAACTGAGTGTTCCTGGAATAAGAATATCAGGTGTTGAACTC TTGAAGAAAACTCCATCACCTCGGATAATAAAGACACATCTTCCAATCGATCTACTCCCAAAATCCTTCT GGGAGAACAAGTGCAAGATGATTTACCTTGCTCGAAATGGCAAGGATGTTGCTGTCTCCTATTATCATTT TGATCTGATGAATAGTATTAATCCTCTTCCTGGCACCTGGGAAGAATATCTGGAGAAATTCCTAGCTGGA AATGTGGCCTATGGTTCATGGTTTGATCATGTTAAGAGTTGGTGGGAAAAGAGGGAAGAGCATCCTTTAC TTTACTTATACTATGAAGAATTGAAACAGAACCCAAAGAAAGAAATCAAGAAGATAGCCAGCTTTCTAGA CAAGACCTTGGATGAAGAGGCCTTGGACAGGATCGTCCATCACACCTCCTTTGAAATGATGAAGGAAAAC CCCCTGGTCAATTACACCCATCTGCCCACAGCAATGATGGACCACAGCAAGTCCCCTTTCATGAGAAAAG GTATTGTTGGGGACTGGAAAAATTACTTCACAATGACCCAAACTGAGCAATTTGATGCTGTCTATAAGAA GAAGATGTCTGGAACAACACTTGAGTTCTGCACAGACATTCAGAGTGCCTAATCTACAACTTGAATATAT GGTTTCTTAAAATAGTAACCTGGAAGAGAAATCAAATAGATTCATGAAGGAAAAATAAATGTGCTTTAAA AATGCTAATTGAAAACATACTACACATTCCCCAGCAGGTAATCTTCCAAATGATCTAGAGCCAAGGTCTT TTGTTACCTTAGTTTTCAAAGGATATGTCTTCAGATTTCTAGATTCTTACTGAGTTGAATAAATACATTT TGTGACTTTTGAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_019878 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024361, AAH24361 |
RefSeq Size | 1223 bp |
RefSeq ORF | 900 bp |
Locus ID | 56362 |
UniProt ID | Q9QWG7 |
Cytogenetics | 5 E1 |
Gene Summary | Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. Sulfates L-DOPA and D-DOPA, tyrosine isomers such as DL-m-tyrosine, dopamine and thyroid hormones.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC201833 | Sult1b1 (untagged) - Mouse sulfotransferase family 1B, member 1 (Sult1b1), (10ug) |
USD 300.00 |
|
MG204165 | Sult1b1 (tGFP-tagged) - Mouse sulfotransferase family 1B, member 1 (Sult1b1) |
USD 500.00 |
|
MR204165 | Sult1b1 (Myc-DDK-tagged) - Mouse sulfotransferase family 1B, member 1 (Sult1b1) |
USD 300.00 |
|
MR204165L3 | Lenti ORF clone of Sult1b1 (Myc-DDK-tagged) - Mouse sulfotransferase family 1B, member 1 (Sult1b1) |
USD 600.00 |
|
MR204165L4 | Lenti ORF clone of Sult1b1 (mGFP-tagged) - Mouse sulfotransferase family 1B, member 1 (Sult1b1) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review