Pla2g16 (NM_139269) Mouse Untagged Clone
CAT#: MC201815
Pla2g16 (untagged) - Mouse phospholipase A2, group XVI (Pla2g16), (10ug)
"NM_139269" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Pla2g16 |
Synonyms | C78643; Hrasls3; Hrev107; HRSL3; MLP-3 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024581 sequence for NM_139269
CGGACGCGTGGGCGAGGAGGTTGGAGAGTTTTTTTCTGGGACCCAAGCAAAGGCATCCACGCTGCTGCTA AGCTGAAATTGAAGCTCACACATCCTGGAAAATGCTAGCACCCATACCAGAACCCAAGCCTGGAGACCTG ATTGAGATTTTCCGCCCTATGTACAGACACTGGGCCATCTATGTTGGTGATGGATACGTGATCCACCTGG CTCCTCCAAGTGAAGTCGCAGGAGCTGGGGCAGCCAGCATCATGTCTGCTTTGACTGACAAGGCCATAGT GAAGAAAGAACTGCTGTGCCATGTGGCCGGGAAGGACAAGTACCAAGTCAATAACAAACATGACGAGGAG TACACCCCACTGCCTCTGAGCAAGATCATCCAGCGGGCTGAGAGACTGGTGGGGCAGGAGGTGCTCTACA GGCTGACCAGCGAGAACTGTGAGCACTTTGTGAATGAACTACGCTATGGAGTTCCTCGGAGTGATCAGGT CAGAGATGCGGTCAAGGCGGTAGGCATCGCTGGAGTGGGCTTGGCGGCTTTGGGCCTCGTTGGAGTCATG CTCTCCAGAAACAAGAAACAGAAGCAATGAGCTGAATGACTGCCCAGTTTTTGGGCTCTTCTTTTGCTAG AGGGTTTGGAGTTTGATTTATAGATTCTATTGCTTTATAATTAGGTTTATTTTCACAACATACAATAAAC CACAAGAAAGGAATTTTTGTGAGGAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_139269 |
Insert Size | 489 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024581, AAH24581 |
RefSeq Size | 739 bp |
RefSeq ORF | 489 bp |
Locus ID | 225845 |
UniProt ID | Q8R3U1 |
Cytogenetics | 19 A |
Gene Summary | Exhibits both phospholipase A1/2 and acyltransferase activities (PubMed:19047760). Shows phospholipase A1 (PLA1) and A2 (PLA2), catalyzing the calcium-independent release of fatty acids from the sn-1 or sn-2 position of glycerophospholipids (PubMed:18614531, PubMed:19047760, PubMed:19136964, PubMed:22134920). For most substrates, PLA1 activity is much higher than PLA2 activity (By similarity). Shows O-acyltransferase activity, catalyzing the transfer of a fatty acyl group from glycerophospholipid to the hydroxyl group of lysophospholipid (By similarity). Shows N-acyltransferase activity,catalyzing the calcium-independent transfer of a fatty acyl group at the sn-1 position of phosphatidylcholine (PC) and other glycerophospholipids to the primary amine of phosphatidylethanolamine (PE), forming N-acylphosphatidylethanolamine (NAPE), which serves as precursor for N-acylethanolamines (NAEs) (PubMed:19047760). Exhibits high N-acyltransferase activity and low phospholipase A1/2 activity (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201283 | Pla2g16 (tGFP-tagged) - Mouse HRAS like suppressor 3 (Hrasls3) |
USD 350.00 |
|
MR201283 | Pla2g16 (Myc-DDK-tagged) - Mouse phospholipase A2, group XVI (Pla2g16) |
USD 150.00 |
|
MR201283L3 | Lenti ORF clone of Pla2g16 (Myc-DDK-tagged) - Mouse phospholipase A2, group XVI (Pla2g16) |
USD 450.00 |
|
MR201283L4 | Lenti ORF clone of Pla2g16 (mGFP-tagged) - Mouse phospholipase A2, group XVI (Pla2g16) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review