Mnd1 (NM_029797) Mouse Untagged Clone
CAT#: MC201576
Mnd1 (untagged) - Mouse meiotic nuclear divisions 1 homolog (S. cerevisiae) (Mnd1), (10ug)
"NM_029797" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mnd1 |
Synonyms | 2610034E18Rik; AI591601; Gaj |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027741 sequence for NM_029797
CACGCGGTTGTTGGCGCCAGACTCAAACAGGGAGGCCGCCTCGCGCAGCATGTCAAAGAAAAGAGGACTG AGTGGGGAGGAAAAGAGAACCCGGATGATGGAGATATTTTTTGAGACAAAAGATGTATTCCAGCTGAAAG ACCTGGAGAAGCTCGCTCCCAAAGAGAAAGGCATAACCGCCATGTCAGTGAAGGAAGTCCTTCAGAGCCT AGTGGATGATGGTATGGTTGACTGTGAGAGGATCGGGACGTCCAATTACTATTGGGCTTTTCCGAGCAAG GCTCTTCATGCCAGGAAGCGCAAGTTGGAGGCTCTGAACTCTCAGCTGTCAGAGGGAAGCCAGAAGCATG CAGACTTACAGAAGAGCATTGAGAAAGCAAGAGTTGGCCGGCAAGAGACGGAAGAACGAGCCATGCTTGC AAAAGAACTTTCTTCATTTCGAGACCAAAGGCAACAACTTAAGGCAGAAGTGGAAAAATATCGAGAATGT GACCCACAGGTTGTGGAAGAGATACGTGAAGCAAATAAAGTAGCTAAAGAAGCCGCCAATCGATGGACTG ATAACATATTTGCAATAAAATCCTGGGCCAAAAGAAAATTTGGGTTTGAAGAAAGTAAAATTGATAAAAA CTTTGGAATTCCAGAAGACTTTGACTACATAGACTAAAATGTTGGTGCTGAACAAGGATCTGGGAGCTTG TGAATATGTCAAGGTTTAAACAGCTAACTAATGTTACCCAGTTATCATCTATCTGCTAATTGTTTATCGT TTTGTAGCTTTAAATAAAGTATACAATAAGGAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_029797 |
Insert Size | 618 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027741, AAH27741 |
RefSeq Size | 825 bp |
RefSeq ORF | 618 bp |
Locus ID | 76915 |
UniProt ID | Q8K396 |
Cytogenetics | 3 F1 |
Gene Summary | Required for proper homologous chromosome pairing and efficient cross-over and intragenic recombination during meiosis. Stimulates both DMC1- and RAD51-mediated homologous strand assimilation, which is required for the resolution of meiotic double-strand breaks.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202161 | Mnd1 (tGFP-tagged) - Mouse meiotic nuclear divisions 1 homolog (S. cerevisiae) (Mnd1) |
USD 500.00 |
|
MR202161 | Mnd1 (Myc-DDK-tagged) - Mouse meiotic nuclear divisions 1 homolog (S. cerevisiae) (Mnd1) |
USD 300.00 |
|
MR202161L3 | Lenti ORF clone of Mnd1 (Myc-DDK-tagged) - Mouse meiotic nuclear divisions 1 homolog (S. cerevisiae) (Mnd1) |
USD 600.00 |
|
MR202161L4 | Lenti ORF clone of Mnd1 (mGFP-tagged) - Mouse meiotic nuclear divisions 1 homolog (S. cerevisiae) (Mnd1) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review