Nol3 (NM_030152) Mouse Untagged Clone
CAT#: MC201500
Nol3 (untagged) - Mouse nucleolar protein 3 (apoptosis repressor with CARD domain) (Nol3), (10ug)
"NM_030152" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Nol3 |
Synonyms | ARC; B430311C09Rik; MYC; NOP; Nop30 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC027290 sequence for NM_030152
GCTGTTCGCGTACCCACCCCGCTCGCTCGCTCGCTTGGCCCTTTCTGCACTGTCATCTGCCCCGGTGAGG CTCAACTCCGGAGTGGGACTATCCGAAACGCTCCGGACCACAAGCCCGACTCCACCCAGCAGGGAGGGAA AGGAGACAGATTGGGCAGAATCCCAGGCCTCACCACCAGCAGCGGAGTTCGAAGAAATGGGCAACGTGCA GGAGCGCCCATCAGAGACCATTGACCGGGAACGGAAACGGCTGGTAGAGACATTGCAGGCTGACTCTGGG CTGCTGCTGGATGCGCTGGTGGCCCGGGGCGTCCTCACTGGGCCCGAGTACGAAGCCTTGGATGCGCTGC CCGATGCAGAGCGCAGGGTGCGCCGCCTACTGCTGTTGGTGCAGAGCAAGGGCGAGGCAGCCTGCCAGGA GCTACTGCGCTGTGCCCAGCAAACAGTGCGCATGCCAGACCCGGCCTGGGATTGGCAGCACGTGGGGCCC GGCTACCGGAACCGCAGCTATGACCCTTCATGCCCAGGCCACTGGACGCCAGAAGCACCCAGTTCAGGGA CCACATGTCCTGAGCTGCCAAGAGCGTCAGAGCAAGAGGAGGTCGGAGGTCCTGAGGGCTCTGAGGCACT GCAGCCTCGAACTCCAGAGGAGCCAGAACTAGAAGCTGAAGCTACTGAAGGGGATGAGCCAGACCTGGAA CAAGAAATGAATCCAGAACAAGAGCCGGAGCCGGAGCCCGAGCCAGAACCCGAACCCGAGCCCGAGCCGG AACCCGAGCCCGAGCCAGAACCCGAGCCCGAGCCGGAACCCGAACCCGAGCCCGACTTCCAAGAAGAGGA TGAATTTGAAGATTCCTGAAGGCCAGAATCCTTAGCTGTCCAATCCTATTTGTGCTGGATAAGACCTGGA AACCTGCCAGAGCTTGACCCCATCGATGCACCGAGACACCTACTGCCAAATGAATAAACTCAGGAGGGTC AGTCTGTTCCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_030152 |
Insert Size | 663 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC027290, AAH27290 |
RefSeq Size | 1022 bp |
RefSeq ORF | 663 bp |
Locus ID | 78688 |
UniProt ID | Q9D1X0 |
Cytogenetics | 8 53.04 cM |
Gene Summary | Apoptosis repressor that blocks multiple modes of cell death. Inhibits extrinsic apoptotic pathways through two different ways. Firstly by interacting with FAS and FADD upon FAS activation blocking death-inducing signaling complex (DISC) assembly (By similarity). Secondly by interacting with CASP8 in a mitochondria localization- and phosphorylation-dependent manner, limiting the amount of soluble CASP8 available for DISC-mediated activation (By similarity). Inhibits intrinsic apoptotic pathway in response to a wide range of stresses, through its interaction with BAX resulting in BAX inactivation, preventing mitochondrial dysfunction and release of pro-apoptotic factors (PubMed:16505176) (PubMed:24312627). Inhibits calcium-mediated cell death by functioning as a cytosolic calcium buffer, dissociating its interaction with CASP8 and maintaining calcium homeostasis (By similarity). Negatively regulates oxidative stress-induced apoptosis by phosphorylation-dependent suppression of the mitochondria-mediated intrinsic pathway, by blocking CASP2 activation and BAX translocation (By similarity). Negatively regulates hypoxia-induced apoptosis in part by inhibiting the release of cytochrome c from mitochondria in a caspase-independent manner (By similarity). Also inhibits TNF-induced necrosis by preventing TNF-signaling pathway through TNFRSF1A interaction abrogating the recruitment of RIPK1 to complex I (PubMed:24440909). Finally through its role as apoptosis repressor, promotes vascular remodeling through inhibition of apoptosis and stimulation of proliferation, in response to hypoxia (PubMed:22082675). Inhibits too myoblast differentiation through caspase inhibition (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202500 | Nol3 (tGFP-tagged) - Mouse nucleolar protein 3 (apoptosis repressor with CARD domain) (Nol3) |
USD 500.00 |
|
MR202500 | Nol3 (Myc-DDK-tagged) - Mouse nucleolar protein 3 (apoptosis repressor with CARD domain) (Nol3) |
USD 300.00 |
|
MR202500L3 | Lenti ORF clone of Nol3 (Myc-DDK-tagged) - Mouse nucleolar protein 3 (apoptosis repressor with CARD domain) (Nol3) |
USD 600.00 |
|
MR202500L4 | Lenti ORF clone of Nol3 (mGFP-tagged) - Mouse nucleolar protein 3 (apoptosis repressor with CARD domain) (Nol3) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review