Aif1 (NM_019467) Mouse Untagged Clone
CAT#: MC201324
Aif1 (untagged) - Mouse allograft inflammatory factor 1 (Aif1), (10ug)
"NM_019467" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Aif1 |
Synonyms | AI607846; AIF-1; D17H6S50E; G1; Iba1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC021539 sequence for NM_019467
CCACGCGTCCGCTGGGGTGCTGGTGTCAGCAGAAGCTGATGTGGAAGTGATGCCTGGGAGTTAGCAAGGG AATGAGTGGAAAGGGGAAGTGTGAGAACGGTCCCAGAAGAGACTGGGGAGCTGGTGGAGAGAGGACCCAG CGGACAGACTGCCAGCCTAAGACAACCAGCGTCTGAGGAGCCATGAGCCAAAGCAGGGATTTGCAGGGAG GAAAAGCTTTTGGACTGCTGAAGGCCCAGCAGGAAGAGAGGCTGGAGGGGATCAACAAGCAATTCCTCGA TGATCCCAAATACAGCAATGATGAGGATCTGCCGTCCAAACTTGAAGCCTTCAAGGTGAAATACATGGAG TTTGATCTGAATGGAAATGGAGATATCGATATTATGTCCTTGAAGCGAATGCTGGAGAAACTTGGGGTTC CCAAGACCCACCTAGAGCTGAAGAGATTAATTAGAGAGGTGTCCAGTGGCTCCGAGGAGACGTTCAGCTA CTCTGACTTTCTCAGAATGATGCTGGGCAAGAGATCTGCCATCTTGAGAATGATTCTGATGTATGAGGAG AAAAACAAAGAACACAAGAGGCCAACTGGTCCCCCAGCCAAGAAAGCTATCTCCGAGCTGCCCTGATTGG AGGTGGATGTCACACGGTGGGGCTGAGTGAGGAGCTTCTGATGACAGCAGCATGGAAAAAAGAAACAGTC GTGAGCCAGAGTCAGACTAAATAAATGACGCTCCTAGTGGGTCAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_019467 |
Insert Size | 444 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC021539, AAH21539 |
RefSeq Size | 780 bp |
RefSeq ORF | 444 bp |
Locus ID | 11629 |
UniProt ID | O70200 |
Cytogenetics | 17 18.59 cM |
Gene Summary | Actin-binding protein that enhances membrane ruffling and RAC activation. Enhances the actin-bundling activity of LCP1. Binds calcium. Plays a role in RAC signaling and in phagocytosis. May play a role in macrophage activation and function. Promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes. Enhances lymphocyte migration. Plays a role in vascular inflammation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201000 | Aif1 (tGFP-tagged) - Mouse allograft inflammatory factor 1 (Aif1) |
USD 350.00 |
|
MR201000 | Aif1 (Myc-DDK-tagged) - Mouse allograft inflammatory factor 1 (Aif1) |
USD 150.00 |
|
MR201000L3 | Lenti ORF clone of Aif1 (Myc-DDK-tagged) - Mouse allograft inflammatory factor 1 (Aif1) |
USD 450.00 |
|
MR201000L4 | Lenti ORF clone of Aif1 (mGFP-tagged) - Mouse allograft inflammatory factor 1 (Aif1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review