Mrto4 (NM_023536) Mouse Untagged Clone
CAT#: MC200549
Mrto4 (untagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA, (10ug)
"NM_023536" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Mrto4 |
Synonyms | 2610012O22Rik; Mg684; Mrt4 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC005734 sequence for NM_023536
CGATGCCCAAATCCAAGCGAGACAAGAAAGTTTCTTTAACAAAAACTGCCAAGAAAGGCTTGGAACTGAA GCAGAACCTGATAGAAGAGCTTCGGAAATGTGTGGACACCTACAAGTACCTTTTCATCTTCTCTGTGGCC AACATGAGGAACAGCAAGCTGAAAGACATCCGGAACGCCTGGAAACACAGCCGGATGTTCTTTGGCAAAA ACAAGGTGATGATGGTGGCCTTGGGTCGAAGCCCATCTGATGAATACAAAGACAACCTACATCAGGTCAG CAAGAAGTTGAGAGGTGAAGTTGGGCTGCTGTTTACCAACCGCACGAAGGAGGAGGTGAATGAGTGGTTC ACCAAGTATACAGAAATGGATTTTGCTCGAGCGGGGAACAAAGCAACTCTAACTGTGAGCCTGGATCCAG GGCCCCTGAAGCAATTCCCTCACTCCATGGAGCCACAGCTGAGGCAGCTGGGGCTGCCCACTGCCCTCAA GAAAGGTGTGGTGACCCTGCTGTCTGACTATGAAGTATGCAAAGAGGGTGACGTGCTGACCCCAGAGCAG GCCCGTATCCTGCTGTTTGGGTATGAGATGGCTGAATTCAAAGTGATCATCAAATACATGTGGGACGCCC AGTCAGGACGATTCCAGCAGATGGACGATGACCTGCCTGAGAGCGCGCCTGAGTCTGAGGGAGAGTCTGA GGAGGAGGATGACAGCTGACTCTGAGAGCCAGGACTATGGCCTTCCAGCGAGTTCTTCATCTTTGCTGGA CACCCCACCCCACCTCACCCTGCCCCCGGACTGCTGTCACCACTCTAGAGGGAACAGCTATTTATTTTGC TATGGACAAAGACAAGGGAGGGTGCTAGGGAATGATTTTGTTTCTATAAAGAATAAAATTGTGTCCGCGG GGTGTTCCCGGGAGACAGCAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_023536 |
Insert Size | 717 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC005734, AAH05734 |
RefSeq Size | 954 bp |
RefSeq ORF | 717 bp |
Locus ID | 69902 |
UniProt ID | Q9D0I8 |
Cytogenetics | 4 D3 |
Gene Summary | Component of the ribosome assembly machinery. Nuclear paralog of the ribosomal protein P0, it binds pre-60S subunits at an early stage of assembly in the nucleolus, and is replaced by P0 in cytoplasmic pre-60S subunits and mature 80S ribosomes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. It encodes isoform 2, which is shorter by an amino acid, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202929 | Mrto4 (tGFP-tagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA |
USD 500.00 |
|
MR202929 | Mrto4 (Myc-DDK-tagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA |
USD 300.00 |
|
MR202929L3 | Lenti ORF clone of Mrto4 (Myc-DDK-tagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA |
USD 600.00 |
|
MR202929L4 | Lenti ORF clone of Mrto4 (mGFP-tagged) - Mouse MRT4 turnover 4, homolog (S. cerevisiae) (Mrto4), mRNA |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review