Psma7 (NM_011969) Mouse Untagged Clone
CAT#: MC200265
Psma7 (untagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 7 (Psma7), (10ug)
"NM_011969" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Psma7 |
Synonyms | C6-I |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC008222 sequence for NM_011969
GCCCGAGCTAGTGCGTCCGCAGTGATGAGCTACGACCGCGCCATCACCGTCTTCTCGCCCGACGGCCACC TCTTCCAAGTGGAGTACGCGCAGGAGGCGGTCAAAAAGGGCTCCACCGCGGTTGGTGTTCGAGGAAAGGA CATTGTTGTTCTTGGTGTGGAAAAAAAATCAGTGGCCAAGCTACAAGATGAAAGAACAGTACGAAAAATC TGCGCCTTGGACGATAACGTCTGTATGGCCTTTGCAGGTCTCACCGCTGATGCAAGGATAGTCATCAACA GAGCCCGGGTAGAGTGCCAGAGCCACCGGCTGACAGTGGAGGACCCAGTGACTGTGGAGTACATCACCCG CTACATTGCGAGTCTGAAGCAGCGTTATACACAGAGCAATGGGCGCAGGCCATTTGGTATCTCGGCCCTA ATTGTGGGTTTTGACTTTGATGGCACTCCCAGACTCTATCAGACTGACCCCTCGGGCACATACCATGCTT GGAAGGCCAATGCCATAGGCCGGGGCGCCAAGTCAGTGCGTGAATTTCTGGAGAAGAACTACACAGATGA TGCCATTGAAACAGATGATCTGACCATCAAACTTGTGATCAAGGCACTGTTAGAGGTGGTCCAGTCAGGT GGCAAAAACATCGAACTTGCCGTCATGAGGCGGGATCAGCCCCTCAAGATTCTAAATCCTGAAGAAATTG AGAAGTATGTTGCTGAAATTGAGAAGGAGAAAGAAGAAAATGAAAAGAAGAAGCAAAAGAAAGCATCTTG ATGAAGAGGCACTGGTCAGAGCAGCTTTGAGCCTCTATCCGGGCAAGCCTCGGTGCTGTGGGCCTTGTGG CCATTTGTCCGAGTTCAATAAACTACTACATTTTTTAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011969 |
Insert Size | 747 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC008222, AAH08222 |
RefSeq Size | 892 bp |
RefSeq ORF | 747 bp |
Locus ID | 26444 |
UniProt ID | Q9Z2U0 |
Cytogenetics | 2 H4 |
Gene Summary | Component of the 20S core proteasome complex involved in the proteolytic degradation of most intracellular proteins. This complex plays numerous essential roles within the cell by associating with different regulatory particles. Associated with two 19S regulatory particles, forms the 26S proteasome and thus participates in the ATP-dependent degradation of ubiquitinated proteins. The 26S proteasome plays a key role in the maintenance of protein homeostasis by removing misfolded or damaged proteins that could impair cellular functions, and by removing proteins whose functions are no longer required. Associated with the PA200 or PA28, the 20S proteasome mediates ubiquitin-independent protein degradation. This type of proteolysis is required in several pathways including spermatogenesis (20S-PA200 complex) or generation of a subset of MHC class I-presented antigenic peptides (20S-PA28 complex).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203141 | Psma7 (tGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 7 (Psma7) |
USD 650.00 |
|
MR203141 | Psma7 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 7 (Psma7) |
USD 450.00 |
|
MR203141L1 | Lenti ORF clone of Psma7 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 7 (Psma7) |
USD 750.00 |
|
MR203141L2 | Lenti ORF clone of Psma7 (mGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 7 (Psma7) |
USD 750.00 |
|
MR203141L3 | Lenti ORF clone of Psma7 (Myc-DDK-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 7 (Psma7) |
USD 750.00 |
|
MR203141L4 | Lenti ORF clone of Psma7 (mGFP-tagged) - Mouse proteasome (prosome, macropain) subunit, alpha type 7 (Psma7) |
USD 750.00 |
{0} Product Review(s)
Be the first one to submit a review